ID: 986488540

View in Genome Browser
Species Human (GRCh38)
Location 5:8265725-8265747
Sequence TCCCAAAGTGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1020377
Summary {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986488533_986488540 7 Left 986488533 5:8265695-8265717 CCGACATCAGATGGTTCACCCGC No data
Right 986488540 5:8265725-8265747 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
986488530_986488540 26 Left 986488530 5:8265676-8265698 CCAGGCTGGTCTCAAACTCCCGA 0: 1131
1: 47293
2: 122314
3: 180501
4: 202586
Right 986488540 5:8265725-8265747 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
986488532_986488540 8 Left 986488532 5:8265694-8265716 CCCGACATCAGATGGTTCACCCG No data
Right 986488540 5:8265725-8265747 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986488540 Original CRISPR TCCCAAAGTGCTGGGATTAC AGG Intergenic
Too many off-targets to display for this crispr