ID: 986488619

View in Genome Browser
Species Human (GRCh38)
Location 5:8266405-8266427
Sequence AACCTTGGATTACTATCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986488615_986488619 7 Left 986488615 5:8266375-8266397 CCCCTAAATGGCATATTTGAATT No data
Right 986488619 5:8266405-8266427 AACCTTGGATTACTATCTACAGG No data
986488617_986488619 5 Left 986488617 5:8266377-8266399 CCTAAATGGCATATTTGAATTCT No data
Right 986488619 5:8266405-8266427 AACCTTGGATTACTATCTACAGG No data
986488613_986488619 24 Left 986488613 5:8266358-8266380 CCACTCTAATTGACTTTCCCCTA No data
Right 986488619 5:8266405-8266427 AACCTTGGATTACTATCTACAGG No data
986488616_986488619 6 Left 986488616 5:8266376-8266398 CCCTAAATGGCATATTTGAATTC No data
Right 986488619 5:8266405-8266427 AACCTTGGATTACTATCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986488619 Original CRISPR AACCTTGGATTACTATCTAC AGG Intergenic
No off target data available for this crispr