ID: 986488890

View in Genome Browser
Species Human (GRCh38)
Location 5:8269341-8269363
Sequence ACACAGAGCCTCAGCCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986488890_986488891 -3 Left 986488890 5:8269341-8269363 CCACGGTGGCTGAGGCTCTGTGT No data
Right 986488891 5:8269361-8269383 TGTCTTAGAAGCTGATATGTTGG No data
986488890_986488895 13 Left 986488890 5:8269341-8269363 CCACGGTGGCTGAGGCTCTGTGT No data
Right 986488895 5:8269377-8269399 ATGTTGGGGAATCCCAGATAGGG No data
986488890_986488894 12 Left 986488890 5:8269341-8269363 CCACGGTGGCTGAGGCTCTGTGT No data
Right 986488894 5:8269376-8269398 TATGTTGGGGAATCCCAGATAGG No data
986488890_986488893 -1 Left 986488890 5:8269341-8269363 CCACGGTGGCTGAGGCTCTGTGT No data
Right 986488893 5:8269363-8269385 TCTTAGAAGCTGATATGTTGGGG No data
986488890_986488898 30 Left 986488890 5:8269341-8269363 CCACGGTGGCTGAGGCTCTGTGT No data
Right 986488898 5:8269394-8269416 ATAGGGACCCACCCACCATGTGG No data
986488890_986488892 -2 Left 986488890 5:8269341-8269363 CCACGGTGGCTGAGGCTCTGTGT No data
Right 986488892 5:8269362-8269384 GTCTTAGAAGCTGATATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986488890 Original CRISPR ACACAGAGCCTCAGCCACCG TGG (reversed) Intergenic
No off target data available for this crispr