ID: 986492622

View in Genome Browser
Species Human (GRCh38)
Location 5:8307849-8307871
Sequence TGGTGAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986492610_986492622 24 Left 986492610 5:8307802-8307824 CCCTGCCGGATCCTGAGGTGTGG No data
Right 986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG No data
986492615_986492622 13 Left 986492615 5:8307813-8307835 CCTGAGGTGTGGAAGTCAACGGT No data
Right 986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG No data
986492612_986492622 23 Left 986492612 5:8307803-8307825 CCTGCCGGATCCTGAGGTGTGGA No data
Right 986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG No data
986492613_986492622 19 Left 986492613 5:8307807-8307829 CCGGATCCTGAGGTGTGGAAGTC No data
Right 986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986492622 Original CRISPR TGGTGAACAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr