ID: 986493490

View in Genome Browser
Species Human (GRCh38)
Location 5:8317905-8317927
Sequence CGTAATACTCTGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986493490_986493500 19 Left 986493490 5:8317905-8317927 CCCTCCCCCATCAGAGTATTACG No data
Right 986493500 5:8317947-8317969 GCTTTGTTTGTCCCTTAACAAGG No data
986493490_986493501 20 Left 986493490 5:8317905-8317927 CCCTCCCCCATCAGAGTATTACG No data
Right 986493501 5:8317948-8317970 CTTTGTTTGTCCCTTAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986493490 Original CRISPR CGTAATACTCTGATGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr