ID: 986494317

View in Genome Browser
Species Human (GRCh38)
Location 5:8327220-8327242
Sequence GCTTTGGACTCAAGCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986494305_986494317 26 Left 986494305 5:8327171-8327193 CCCAGTGAAGCTGAGTTGCTGGC No data
Right 986494317 5:8327220-8327242 GCTTTGGACTCAAGCAGAGGGGG No data
986494309_986494317 -4 Left 986494309 5:8327201-8327223 CCAGGTCCTCAATCCCACTGCTT No data
Right 986494317 5:8327220-8327242 GCTTTGGACTCAAGCAGAGGGGG No data
986494311_986494317 -10 Left 986494311 5:8327207-8327229 CCTCAATCCCACTGCTTTGGACT No data
Right 986494317 5:8327220-8327242 GCTTTGGACTCAAGCAGAGGGGG No data
986494306_986494317 25 Left 986494306 5:8327172-8327194 CCAGTGAAGCTGAGTTGCTGGCG No data
Right 986494317 5:8327220-8327242 GCTTTGGACTCAAGCAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986494317 Original CRISPR GCTTTGGACTCAAGCAGAGG GGG Intergenic
No off target data available for this crispr