ID: 986498856

View in Genome Browser
Species Human (GRCh38)
Location 5:8376660-8376682
Sequence TGCGGTCATGGTGGTTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986498856_986498866 16 Left 986498856 5:8376660-8376682 CCTAGGAAACCACCATGACCGCA No data
Right 986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG No data
986498856_986498865 15 Left 986498856 5:8376660-8376682 CCTAGGAAACCACCATGACCGCA No data
Right 986498865 5:8376698-8376720 ATCGGAACAGCATAATGAGGTGG No data
986498856_986498862 -3 Left 986498856 5:8376660-8376682 CCTAGGAAACCACCATGACCGCA No data
Right 986498862 5:8376680-8376702 GCAGGAACCACAGGTCATATCGG No data
986498856_986498864 12 Left 986498856 5:8376660-8376682 CCTAGGAAACCACCATGACCGCA No data
Right 986498864 5:8376695-8376717 CATATCGGAACAGCATAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986498856 Original CRISPR TGCGGTCATGGTGGTTTCCT AGG (reversed) Intergenic
No off target data available for this crispr