ID: 986498858

View in Genome Browser
Species Human (GRCh38)
Location 5:8376669-8376691
Sequence TGTGGTTCCTGCGGTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986498858_986498865 6 Left 986498858 5:8376669-8376691 CCACCATGACCGCAGGAACCACA No data
Right 986498865 5:8376698-8376720 ATCGGAACAGCATAATGAGGTGG No data
986498858_986498866 7 Left 986498858 5:8376669-8376691 CCACCATGACCGCAGGAACCACA No data
Right 986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG No data
986498858_986498867 25 Left 986498858 5:8376669-8376691 CCACCATGACCGCAGGAACCACA No data
Right 986498867 5:8376717-8376739 GTGGGTGAGAAGAGCAGTTTAGG No data
986498858_986498864 3 Left 986498858 5:8376669-8376691 CCACCATGACCGCAGGAACCACA No data
Right 986498864 5:8376695-8376717 CATATCGGAACAGCATAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986498858 Original CRISPR TGTGGTTCCTGCGGTCATGG TGG (reversed) Intergenic
No off target data available for this crispr