ID: 986498861

View in Genome Browser
Species Human (GRCh38)
Location 5:8376678-8376700
Sequence GATATGACCTGTGGTTCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986498861_986498867 16 Left 986498861 5:8376678-8376700 CCGCAGGAACCACAGGTCATATC No data
Right 986498867 5:8376717-8376739 GTGGGTGAGAAGAGCAGTTTAGG No data
986498861_986498864 -6 Left 986498861 5:8376678-8376700 CCGCAGGAACCACAGGTCATATC No data
Right 986498864 5:8376695-8376717 CATATCGGAACAGCATAATGAGG No data
986498861_986498865 -3 Left 986498861 5:8376678-8376700 CCGCAGGAACCACAGGTCATATC No data
Right 986498865 5:8376698-8376720 ATCGGAACAGCATAATGAGGTGG No data
986498861_986498868 26 Left 986498861 5:8376678-8376700 CCGCAGGAACCACAGGTCATATC No data
Right 986498868 5:8376727-8376749 AGAGCAGTTTAGGTGCTCTGTGG No data
986498861_986498866 -2 Left 986498861 5:8376678-8376700 CCGCAGGAACCACAGGTCATATC No data
Right 986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986498861 Original CRISPR GATATGACCTGTGGTTCCTG CGG (reversed) Intergenic
No off target data available for this crispr