ID: 986498866

View in Genome Browser
Species Human (GRCh38)
Location 5:8376699-8376721
Sequence TCGGAACAGCATAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986498858_986498866 7 Left 986498858 5:8376669-8376691 CCACCATGACCGCAGGAACCACA No data
Right 986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG No data
986498861_986498866 -2 Left 986498861 5:8376678-8376700 CCGCAGGAACCACAGGTCATATC No data
Right 986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG No data
986498856_986498866 16 Left 986498856 5:8376660-8376682 CCTAGGAAACCACCATGACCGCA No data
Right 986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG No data
986498860_986498866 4 Left 986498860 5:8376672-8376694 CCATGACCGCAGGAACCACAGGT No data
Right 986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986498866 Original CRISPR TCGGAACAGCATAATGAGGT GGG Intergenic
No off target data available for this crispr