ID: 986502184

View in Genome Browser
Species Human (GRCh38)
Location 5:8412587-8412609
Sequence TTGGACCCCCAAAATCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986502182_986502184 3 Left 986502182 5:8412561-8412583 CCACAAAACTGTGAAAGCAAAAT No data
Right 986502184 5:8412587-8412609 TTGGACCCCCAAAATCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986502184 Original CRISPR TTGGACCCCCAAAATCACTA AGG Intergenic
No off target data available for this crispr