ID: 986505478

View in Genome Browser
Species Human (GRCh38)
Location 5:8445642-8445664
Sequence TCTTCTGTATATGGTGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986505478_986505481 23 Left 986505478 5:8445642-8445664 CCTTTCACACCATATACAGAAGA No data
Right 986505481 5:8445688-8445710 TTGAACAGCAGGCTAGCAGCAGG No data
986505478_986505482 24 Left 986505478 5:8445642-8445664 CCTTTCACACCATATACAGAAGA No data
Right 986505482 5:8445689-8445711 TGAACAGCAGGCTAGCAGCAGGG No data
986505478_986505483 30 Left 986505478 5:8445642-8445664 CCTTTCACACCATATACAGAAGA No data
Right 986505483 5:8445695-8445717 GCAGGCTAGCAGCAGGGAACAGG No data
986505478_986505480 12 Left 986505478 5:8445642-8445664 CCTTTCACACCATATACAGAAGA No data
Right 986505480 5:8445677-8445699 AAAACACTTTCTTGAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986505478 Original CRISPR TCTTCTGTATATGGTGTGAA AGG (reversed) Intergenic