ID: 986505479

View in Genome Browser
Species Human (GRCh38)
Location 5:8445651-8445673
Sequence ATTTACTCTTCTTCTGTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986505479_986505483 21 Left 986505479 5:8445651-8445673 CCATATACAGAAGAAGAGTAAAT No data
Right 986505483 5:8445695-8445717 GCAGGCTAGCAGCAGGGAACAGG No data
986505479_986505482 15 Left 986505479 5:8445651-8445673 CCATATACAGAAGAAGAGTAAAT No data
Right 986505482 5:8445689-8445711 TGAACAGCAGGCTAGCAGCAGGG No data
986505479_986505484 22 Left 986505479 5:8445651-8445673 CCATATACAGAAGAAGAGTAAAT No data
Right 986505484 5:8445696-8445718 CAGGCTAGCAGCAGGGAACAGGG No data
986505479_986505480 3 Left 986505479 5:8445651-8445673 CCATATACAGAAGAAGAGTAAAT No data
Right 986505480 5:8445677-8445699 AAAACACTTTCTTGAACAGCAGG No data
986505479_986505486 28 Left 986505479 5:8445651-8445673 CCATATACAGAAGAAGAGTAAAT No data
Right 986505486 5:8445702-8445724 AGCAGCAGGGAACAGGGGCATGG No data
986505479_986505481 14 Left 986505479 5:8445651-8445673 CCATATACAGAAGAAGAGTAAAT No data
Right 986505481 5:8445688-8445710 TTGAACAGCAGGCTAGCAGCAGG No data
986505479_986505485 23 Left 986505479 5:8445651-8445673 CCATATACAGAAGAAGAGTAAAT No data
Right 986505485 5:8445697-8445719 AGGCTAGCAGCAGGGAACAGGGG No data
986505479_986505487 29 Left 986505479 5:8445651-8445673 CCATATACAGAAGAAGAGTAAAT No data
Right 986505487 5:8445703-8445725 GCAGCAGGGAACAGGGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986505479 Original CRISPR ATTTACTCTTCTTCTGTATA TGG (reversed) Intergenic