ID: 986505482

View in Genome Browser
Species Human (GRCh38)
Location 5:8445689-8445711
Sequence TGAACAGCAGGCTAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986505478_986505482 24 Left 986505478 5:8445642-8445664 CCTTTCACACCATATACAGAAGA No data
Right 986505482 5:8445689-8445711 TGAACAGCAGGCTAGCAGCAGGG No data
986505479_986505482 15 Left 986505479 5:8445651-8445673 CCATATACAGAAGAAGAGTAAAT No data
Right 986505482 5:8445689-8445711 TGAACAGCAGGCTAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986505482 Original CRISPR TGAACAGCAGGCTAGCAGCA GGG Intergenic