ID: 986506537

View in Genome Browser
Species Human (GRCh38)
Location 5:8457806-8457828
Sequence CCCGCCTAGCACTGGCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986506524_986506537 21 Left 986506524 5:8457762-8457784 CCCAGGTGAGCGCTCCGGAGGCT 0: 1
1: 0
2: 1
3: 6
4: 77
Right 986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG No data
986506522_986506537 24 Left 986506522 5:8457759-8457781 CCACCCAGGTGAGCGCTCCGGAG 0: 1
1: 0
2: 0
3: 9
4: 99
Right 986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG No data
986506528_986506537 7 Left 986506528 5:8457776-8457798 CCGGAGGCTGCGATCCCCGGGTC No data
Right 986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG No data
986506525_986506537 20 Left 986506525 5:8457763-8457785 CCAGGTGAGCGCTCCGGAGGCTG 0: 1
1: 0
2: 1
3: 14
4: 127
Right 986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG No data
986506531_986506537 -9 Left 986506531 5:8457792-8457814 CCGGGTCCCGACCGCCCGCCTAG No data
Right 986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG No data
986506530_986506537 -8 Left 986506530 5:8457791-8457813 CCCGGGTCCCGACCGCCCGCCTA No data
Right 986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG No data
986506520_986506537 30 Left 986506520 5:8457753-8457775 CCTGCGCCACCCAGGTGAGCGCT 0: 1
1: 0
2: 2
3: 17
4: 127
Right 986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG No data
986506529_986506537 -7 Left 986506529 5:8457790-8457812 CCCCGGGTCCCGACCGCCCGCCT No data
Right 986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986506537 Original CRISPR CCCGCCTAGCACTGGCCTGA TGG Intergenic
No off target data available for this crispr