ID: 986512017

View in Genome Browser
Species Human (GRCh38)
Location 5:8517428-8517450
Sequence CAGAGCAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986512017_986512026 24 Left 986512017 5:8517428-8517450 CCACCCTGCTTCTGCTTGCTCTG No data
Right 986512026 5:8517475-8517497 CGGTCCCAGAGATCTGAACTTGG No data
986512017_986512021 4 Left 986512017 5:8517428-8517450 CCACCCTGCTTCTGCTTGCTCTG No data
Right 986512021 5:8517455-8517477 GATTGCACCCACTGCCTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986512017 Original CRISPR CAGAGCAAGCAGAAGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr