ID: 986512017 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:8517428-8517450 |
| Sequence | CAGAGCAAGCAGAAGCAGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 986512017_986512026 | 24 | Left | 986512017 | 5:8517428-8517450 | CCACCCTGCTTCTGCTTGCTCTG | No data | ||
| Right | 986512026 | 5:8517475-8517497 | CGGTCCCAGAGATCTGAACTTGG | No data | ||||
| 986512017_986512021 | 4 | Left | 986512017 | 5:8517428-8517450 | CCACCCTGCTTCTGCTTGCTCTG | No data | ||
| Right | 986512021 | 5:8517455-8517477 | GATTGCACCCACTGCCTTACCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 986512017 | Original CRISPR | CAGAGCAAGCAGAAGCAGGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||