ID: 986512458

View in Genome Browser
Species Human (GRCh38)
Location 5:8522772-8522794
Sequence AGGGAAACTACTGCATTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986512458_986512462 25 Left 986512458 5:8522772-8522794 CCAGCAAATGCAGTAGTTTCCCT No data
Right 986512462 5:8522820-8522842 TTTTCCTTAGTGTCCTCATGAGG No data
986512458_986512463 26 Left 986512458 5:8522772-8522794 CCAGCAAATGCAGTAGTTTCCCT No data
Right 986512463 5:8522821-8522843 TTTCCTTAGTGTCCTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986512458 Original CRISPR AGGGAAACTACTGCATTTGC TGG (reversed) Intergenic
No off target data available for this crispr