ID: 986514916

View in Genome Browser
Species Human (GRCh38)
Location 5:8551265-8551287
Sequence TTCTGGCCTCCTTGGAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986514916_986514924 13 Left 986514916 5:8551265-8551287 CCACTCTTCCAAGGAGGCCAGAA No data
Right 986514924 5:8551301-8551323 GAGGACTCACCCTGAGCTGCTGG No data
986514916_986514925 14 Left 986514916 5:8551265-8551287 CCACTCTTCCAAGGAGGCCAGAA No data
Right 986514925 5:8551302-8551324 AGGACTCACCCTGAGCTGCTGGG No data
986514916_986514923 -6 Left 986514916 5:8551265-8551287 CCACTCTTCCAAGGAGGCCAGAA No data
Right 986514923 5:8551282-8551304 CCAGAATCTGGTGGGGTCTGAGG No data
986514916_986514927 22 Left 986514916 5:8551265-8551287 CCACTCTTCCAAGGAGGCCAGAA No data
Right 986514927 5:8551310-8551332 CCCTGAGCTGCTGGGATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986514916 Original CRISPR TTCTGGCCTCCTTGGAAGAG TGG (reversed) Intergenic
No off target data available for this crispr