ID: 986524973

View in Genome Browser
Species Human (GRCh38)
Location 5:8664056-8664078
Sequence AAACAATGCCCTCACTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986524973_986524981 18 Left 986524973 5:8664056-8664078 CCGTGGAAGTGAGGGCATTGTTT No data
Right 986524981 5:8664097-8664119 TATGTTGGAATGGGATGTGTGGG No data
986524973_986524977 8 Left 986524973 5:8664056-8664078 CCGTGGAAGTGAGGGCATTGTTT No data
Right 986524977 5:8664087-8664109 TAGGATCCTGTATGTTGGAATGG No data
986524973_986524978 9 Left 986524973 5:8664056-8664078 CCGTGGAAGTGAGGGCATTGTTT No data
Right 986524978 5:8664088-8664110 AGGATCCTGTATGTTGGAATGGG No data
986524973_986524976 3 Left 986524973 5:8664056-8664078 CCGTGGAAGTGAGGGCATTGTTT No data
Right 986524976 5:8664082-8664104 AAGAATAGGATCCTGTATGTTGG No data
986524973_986524982 21 Left 986524973 5:8664056-8664078 CCGTGGAAGTGAGGGCATTGTTT No data
Right 986524982 5:8664100-8664122 GTTGGAATGGGATGTGTGGGAGG No data
986524973_986524980 17 Left 986524973 5:8664056-8664078 CCGTGGAAGTGAGGGCATTGTTT No data
Right 986524980 5:8664096-8664118 GTATGTTGGAATGGGATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986524973 Original CRISPR AAACAATGCCCTCACTTCCA CGG (reversed) Intergenic
No off target data available for this crispr