ID: 986524977

View in Genome Browser
Species Human (GRCh38)
Location 5:8664087-8664109
Sequence TAGGATCCTGTATGTTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986524973_986524977 8 Left 986524973 5:8664056-8664078 CCGTGGAAGTGAGGGCATTGTTT No data
Right 986524977 5:8664087-8664109 TAGGATCCTGTATGTTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986524977 Original CRISPR TAGGATCCTGTATGTTGGAA TGG Intergenic
No off target data available for this crispr