ID: 986534037

View in Genome Browser
Species Human (GRCh38)
Location 5:8767792-8767814
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986534037_986534041 -5 Left 986534037 5:8767792-8767814 CCTCCTTTTGAACTCAGAGTACA No data
Right 986534041 5:8767810-8767832 GTACAGCTAAGAGGGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986534037 Original CRISPR TGTACTCTGAGTTCAAAAGG AGG (reversed) Intergenic
No off target data available for this crispr