ID: 986534041

View in Genome Browser
Species Human (GRCh38)
Location 5:8767810-8767832
Sequence GTACAGCTAAGAGGGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986534035_986534041 24 Left 986534035 5:8767763-8767785 CCAAAGGCAAATGGATCACAATG No data
Right 986534041 5:8767810-8767832 GTACAGCTAAGAGGGATAAATGG No data
986534034_986534041 25 Left 986534034 5:8767762-8767784 CCCAAAGGCAAATGGATCACAAT No data
Right 986534041 5:8767810-8767832 GTACAGCTAAGAGGGATAAATGG No data
986534036_986534041 -4 Left 986534036 5:8767791-8767813 CCCTCCTTTTGAACTCAGAGTAC No data
Right 986534041 5:8767810-8767832 GTACAGCTAAGAGGGATAAATGG No data
986534038_986534041 -8 Left 986534038 5:8767795-8767817 CCTTTTGAACTCAGAGTACAGCT No data
Right 986534041 5:8767810-8767832 GTACAGCTAAGAGGGATAAATGG No data
986534037_986534041 -5 Left 986534037 5:8767792-8767814 CCTCCTTTTGAACTCAGAGTACA No data
Right 986534041 5:8767810-8767832 GTACAGCTAAGAGGGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986534041 Original CRISPR GTACAGCTAAGAGGGATAAA TGG Intergenic
No off target data available for this crispr