ID: 986537426

View in Genome Browser
Species Human (GRCh38)
Location 5:8805375-8805397
Sequence CAAAATGCTGATAGTAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986537423_986537426 4 Left 986537423 5:8805348-8805370 CCTAGAGATTTGTTAAATGGCTG No data
Right 986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986537426 Original CRISPR CAAAATGCTGATAGTAATAT GGG Intergenic
No off target data available for this crispr