ID: 986537485

View in Genome Browser
Species Human (GRCh38)
Location 5:8805879-8805901
Sequence TCCCTTCTGTTTGCAGCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986537475_986537485 25 Left 986537475 5:8805831-8805853 CCAGAGGCCTAGGAGGAAAAAAT 0: 179
1: 628
2: 920
3: 1001
4: 1053
Right 986537485 5:8805879-8805901 TCCCTTCTGTTTGCAGCCTAGGG No data
986537477_986537485 18 Left 986537477 5:8805838-8805860 CCTAGGAGGAAAAAATGGTTTTG 0: 135
1: 512
2: 939
3: 1465
4: 1642
Right 986537485 5:8805879-8805901 TCCCTTCTGTTTGCAGCCTAGGG No data
986537474_986537485 26 Left 986537474 5:8805830-8805852 CCCAGAGGCCTAGGAGGAAAAAA 0: 185
1: 742
2: 1476
3: 1705
4: 1726
Right 986537485 5:8805879-8805901 TCCCTTCTGTTTGCAGCCTAGGG No data
986537481_986537485 -9 Left 986537481 5:8805865-8805887 CCTGGCCCAGGGTCTCCCTTCTG No data
Right 986537485 5:8805879-8805901 TCCCTTCTGTTTGCAGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986537485 Original CRISPR TCCCTTCTGTTTGCAGCCTA GGG Intergenic
No off target data available for this crispr