ID: 986539586 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:8829489-8829511 |
Sequence | GGGTCAGGAGGGTGACTCAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
986539580_986539586 | 5 | Left | 986539580 | 5:8829461-8829483 | CCTGTCTCAGTTGAAGAGCTGGA | No data | ||
Right | 986539586 | 5:8829489-8829511 | GGGTCAGGAGGGTGACTCAGAGG | No data | ||||
986539578_986539586 | 25 | Left | 986539578 | 5:8829441-8829463 | CCTGCAGATAAAAAGAGATGCCT | No data | ||
Right | 986539586 | 5:8829489-8829511 | GGGTCAGGAGGGTGACTCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
986539586 | Original CRISPR | GGGTCAGGAGGGTGACTCAG AGG | Intergenic | ||