ID: 986539586

View in Genome Browser
Species Human (GRCh38)
Location 5:8829489-8829511
Sequence GGGTCAGGAGGGTGACTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986539580_986539586 5 Left 986539580 5:8829461-8829483 CCTGTCTCAGTTGAAGAGCTGGA No data
Right 986539586 5:8829489-8829511 GGGTCAGGAGGGTGACTCAGAGG No data
986539578_986539586 25 Left 986539578 5:8829441-8829463 CCTGCAGATAAAAAGAGATGCCT No data
Right 986539586 5:8829489-8829511 GGGTCAGGAGGGTGACTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986539586 Original CRISPR GGGTCAGGAGGGTGACTCAG AGG Intergenic