ID: 986548231

View in Genome Browser
Species Human (GRCh38)
Location 5:8923574-8923596
Sequence ACCCTGCTGAGGGATGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548231_986548237 8 Left 986548231 5:8923574-8923596 CCTCCTCCATCCCTCAGCAGGGT No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548231_986548238 19 Left 986548231 5:8923574-8923596 CCTCCTCCATCCCTCAGCAGGGT No data
Right 986548238 5:8923616-8923638 GCCTGAGAAAGGAAGAGTGCAGG No data
986548231_986548240 20 Left 986548231 5:8923574-8923596 CCTCCTCCATCCCTCAGCAGGGT No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data
986548231_986548242 28 Left 986548231 5:8923574-8923596 CCTCCTCCATCCCTCAGCAGGGT No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data
986548231_986548241 27 Left 986548231 5:8923574-8923596 CCTCCTCCATCCCTCAGCAGGGT No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548231 Original CRISPR ACCCTGCTGAGGGATGGAGG AGG (reversed) Intergenic
No off target data available for this crispr