ID: 986548232

View in Genome Browser
Species Human (GRCh38)
Location 5:8923577-8923599
Sequence CTCACCCTGCTGAGGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548232_986548237 5 Left 986548232 5:8923577-8923599 CCTCCATCCCTCAGCAGGGTGAG No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548232_986548241 24 Left 986548232 5:8923577-8923599 CCTCCATCCCTCAGCAGGGTGAG No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data
986548232_986548242 25 Left 986548232 5:8923577-8923599 CCTCCATCCCTCAGCAGGGTGAG No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data
986548232_986548238 16 Left 986548232 5:8923577-8923599 CCTCCATCCCTCAGCAGGGTGAG No data
Right 986548238 5:8923616-8923638 GCCTGAGAAAGGAAGAGTGCAGG No data
986548232_986548240 17 Left 986548232 5:8923577-8923599 CCTCCATCCCTCAGCAGGGTGAG No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548232 Original CRISPR CTCACCCTGCTGAGGGATGG AGG (reversed) Intergenic
No off target data available for this crispr