ID: 986548234

View in Genome Browser
Species Human (GRCh38)
Location 5:8923580-8923602
Sequence CTCCTCACCCTGCTGAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548234_986548237 2 Left 986548234 5:8923580-8923602 CCATCCCTCAGCAGGGTGAGGAG No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548234_986548241 21 Left 986548234 5:8923580-8923602 CCATCCCTCAGCAGGGTGAGGAG No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data
986548234_986548238 13 Left 986548234 5:8923580-8923602 CCATCCCTCAGCAGGGTGAGGAG No data
Right 986548238 5:8923616-8923638 GCCTGAGAAAGGAAGAGTGCAGG No data
986548234_986548240 14 Left 986548234 5:8923580-8923602 CCATCCCTCAGCAGGGTGAGGAG No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data
986548234_986548242 22 Left 986548234 5:8923580-8923602 CCATCCCTCAGCAGGGTGAGGAG No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548234 Original CRISPR CTCCTCACCCTGCTGAGGGA TGG (reversed) Intergenic
No off target data available for this crispr