ID: 986548235

View in Genome Browser
Species Human (GRCh38)
Location 5:8923584-8923606
Sequence CTCTCTCCTCACCCTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548235_986548243 29 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548243 5:8923636-8923658 AGGGACTGTGGGACTTTCACTGG No data
986548235_986548241 17 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data
986548235_986548237 -2 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548235_986548242 18 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data
986548235_986548240 10 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data
986548235_986548238 9 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548238 5:8923616-8923638 GCCTGAGAAAGGAAGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548235 Original CRISPR CTCTCTCCTCACCCTGCTGA GGG (reversed) Intergenic
No off target data available for this crispr