ID: 986548237

View in Genome Browser
Species Human (GRCh38)
Location 5:8923605-8923627
Sequence AGAATCTGCGTGCCTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548231_986548237 8 Left 986548231 5:8923574-8923596 CCTCCTCCATCCCTCAGCAGGGT No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548229_986548237 9 Left 986548229 5:8923573-8923595 CCCTCCTCCATCCCTCAGCAGGG No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548226_986548237 19 Left 986548226 5:8923563-8923585 CCAACACCATCCCTCCTCCATCC No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548235_986548237 -2 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548234_986548237 2 Left 986548234 5:8923580-8923602 CCATCCCTCAGCAGGGTGAGGAG No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548232_986548237 5 Left 986548232 5:8923577-8923599 CCTCCATCCCTCAGCAGGGTGAG No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548236_986548237 -3 Left 986548236 5:8923585-8923607 CCTCAGCAGGGTGAGGAGAGAGA No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data
986548227_986548237 13 Left 986548227 5:8923569-8923591 CCATCCCTCCTCCATCCCTCAGC No data
Right 986548237 5:8923605-8923627 AGAATCTGCGTGCCTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548237 Original CRISPR AGAATCTGCGTGCCTGAGAA AGG Intergenic
No off target data available for this crispr