ID: 986548240

View in Genome Browser
Species Human (GRCh38)
Location 5:8923617-8923639
Sequence CCTGAGAAAGGAAGAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548229_986548240 21 Left 986548229 5:8923573-8923595 CCCTCCTCCATCCCTCAGCAGGG No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data
986548227_986548240 25 Left 986548227 5:8923569-8923591 CCATCCCTCCTCCATCCCTCAGC No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data
986548236_986548240 9 Left 986548236 5:8923585-8923607 CCTCAGCAGGGTGAGGAGAGAGA No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data
986548234_986548240 14 Left 986548234 5:8923580-8923602 CCATCCCTCAGCAGGGTGAGGAG No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data
986548231_986548240 20 Left 986548231 5:8923574-8923596 CCTCCTCCATCCCTCAGCAGGGT No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data
986548235_986548240 10 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data
986548232_986548240 17 Left 986548232 5:8923577-8923599 CCTCCATCCCTCAGCAGGGTGAG No data
Right 986548240 5:8923617-8923639 CCTGAGAAAGGAAGAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548240 Original CRISPR CCTGAGAAAGGAAGAGTGCA GGG Intergenic
No off target data available for this crispr