ID: 986548241

View in Genome Browser
Species Human (GRCh38)
Location 5:8923624-8923646
Sequence AAGGAAGAGTGCAGGGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548236_986548241 16 Left 986548236 5:8923585-8923607 CCTCAGCAGGGTGAGGAGAGAGA No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data
986548235_986548241 17 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data
986548231_986548241 27 Left 986548231 5:8923574-8923596 CCTCCTCCATCCCTCAGCAGGGT No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data
986548234_986548241 21 Left 986548234 5:8923580-8923602 CCATCCCTCAGCAGGGTGAGGAG No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data
986548229_986548241 28 Left 986548229 5:8923573-8923595 CCCTCCTCCATCCCTCAGCAGGG No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data
986548232_986548241 24 Left 986548232 5:8923577-8923599 CCTCCATCCCTCAGCAGGGTGAG No data
Right 986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548241 Original CRISPR AAGGAAGAGTGCAGGGACTG TGG Intergenic
No off target data available for this crispr