ID: 986548242

View in Genome Browser
Species Human (GRCh38)
Location 5:8923625-8923647
Sequence AGGAAGAGTGCAGGGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548229_986548242 29 Left 986548229 5:8923573-8923595 CCCTCCTCCATCCCTCAGCAGGG No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data
986548232_986548242 25 Left 986548232 5:8923577-8923599 CCTCCATCCCTCAGCAGGGTGAG No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data
986548236_986548242 17 Left 986548236 5:8923585-8923607 CCTCAGCAGGGTGAGGAGAGAGA No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data
986548231_986548242 28 Left 986548231 5:8923574-8923596 CCTCCTCCATCCCTCAGCAGGGT No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data
986548235_986548242 18 Left 986548235 5:8923584-8923606 CCCTCAGCAGGGTGAGGAGAGAG No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data
986548234_986548242 22 Left 986548234 5:8923580-8923602 CCATCCCTCAGCAGGGTGAGGAG No data
Right 986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548242 Original CRISPR AGGAAGAGTGCAGGGACTGT GGG Intergenic
No off target data available for this crispr