ID: 986548427

View in Genome Browser
Species Human (GRCh38)
Location 5:8924945-8924967
Sequence GTGGCACTGAGTCTCACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548427_986548437 27 Left 986548427 5:8924945-8924967 CCTTGGGTGAGACTCAGTGCCAC No data
Right 986548437 5:8924995-8925017 CCAGTGGTGGTGGTGACAGGAGG No data
986548427_986548438 28 Left 986548427 5:8924945-8924967 CCTTGGGTGAGACTCAGTGCCAC No data
Right 986548438 5:8924996-8925018 CAGTGGTGGTGGTGACAGGAGGG No data
986548427_986548433 17 Left 986548427 5:8924945-8924967 CCTTGGGTGAGACTCAGTGCCAC No data
Right 986548433 5:8924985-8925007 TGCAATAGTCCCAGTGGTGGTGG No data
986548427_986548431 11 Left 986548427 5:8924945-8924967 CCTTGGGTGAGACTCAGTGCCAC No data
Right 986548431 5:8924979-8925001 ATCTGATGCAATAGTCCCAGTGG No data
986548427_986548434 24 Left 986548427 5:8924945-8924967 CCTTGGGTGAGACTCAGTGCCAC No data
Right 986548434 5:8924992-8925014 GTCCCAGTGGTGGTGGTGACAGG No data
986548427_986548432 14 Left 986548427 5:8924945-8924967 CCTTGGGTGAGACTCAGTGCCAC No data
Right 986548432 5:8924982-8925004 TGATGCAATAGTCCCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548427 Original CRISPR GTGGCACTGAGTCTCACCCA AGG (reversed) Intergenic
No off target data available for this crispr