ID: 986548430

View in Genome Browser
Species Human (GRCh38)
Location 5:8924964-8924986
Sequence CATCAGATATGAAGCCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548430_986548438 9 Left 986548430 5:8924964-8924986 CCACGGTGGCTTCATATCTGATG No data
Right 986548438 5:8924996-8925018 CAGTGGTGGTGGTGACAGGAGGG No data
986548430_986548432 -5 Left 986548430 5:8924964-8924986 CCACGGTGGCTTCATATCTGATG No data
Right 986548432 5:8924982-8925004 TGATGCAATAGTCCCAGTGGTGG No data
986548430_986548433 -2 Left 986548430 5:8924964-8924986 CCACGGTGGCTTCATATCTGATG No data
Right 986548433 5:8924985-8925007 TGCAATAGTCCCAGTGGTGGTGG No data
986548430_986548434 5 Left 986548430 5:8924964-8924986 CCACGGTGGCTTCATATCTGATG No data
Right 986548434 5:8924992-8925014 GTCCCAGTGGTGGTGGTGACAGG No data
986548430_986548431 -8 Left 986548430 5:8924964-8924986 CCACGGTGGCTTCATATCTGATG No data
Right 986548431 5:8924979-8925001 ATCTGATGCAATAGTCCCAGTGG No data
986548430_986548437 8 Left 986548430 5:8924964-8924986 CCACGGTGGCTTCATATCTGATG No data
Right 986548437 5:8924995-8925017 CCAGTGGTGGTGGTGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548430 Original CRISPR CATCAGATATGAAGCCACCG TGG (reversed) Intergenic
No off target data available for this crispr