ID: 986548433

View in Genome Browser
Species Human (GRCh38)
Location 5:8924985-8925007
Sequence TGCAATAGTCCCAGTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548430_986548433 -2 Left 986548430 5:8924964-8924986 CCACGGTGGCTTCATATCTGATG No data
Right 986548433 5:8924985-8925007 TGCAATAGTCCCAGTGGTGGTGG No data
986548427_986548433 17 Left 986548427 5:8924945-8924967 CCTTGGGTGAGACTCAGTGCCAC No data
Right 986548433 5:8924985-8925007 TGCAATAGTCCCAGTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548433 Original CRISPR TGCAATAGTCCCAGTGGTGG TGG Intergenic
No off target data available for this crispr