ID: 986548571

View in Genome Browser
Species Human (GRCh38)
Location 5:8926814-8926836
Sequence CACGTACCCTTCTCAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548571_986548580 -2 Left 986548571 5:8926814-8926836 CCAGAGGCTGAGAAGGGTACGTG No data
Right 986548580 5:8926835-8926857 TGGGGGGTCAGGAGGAAGTAGGG No data
986548571_986548581 11 Left 986548571 5:8926814-8926836 CCAGAGGCTGAGAAGGGTACGTG No data
Right 986548581 5:8926848-8926870 GGAAGTAGGGCACAAAAAATAGG No data
986548571_986548579 -3 Left 986548571 5:8926814-8926836 CCAGAGGCTGAGAAGGGTACGTG No data
Right 986548579 5:8926834-8926856 GTGGGGGGTCAGGAGGAAGTAGG No data
986548571_986548578 -10 Left 986548571 5:8926814-8926836 CCAGAGGCTGAGAAGGGTACGTG No data
Right 986548578 5:8926827-8926849 AGGGTACGTGGGGGGTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548571 Original CRISPR CACGTACCCTTCTCAGCCTC TGG (reversed) Intergenic
No off target data available for this crispr