ID: 986548579

View in Genome Browser
Species Human (GRCh38)
Location 5:8926834-8926856
Sequence GTGGGGGGTCAGGAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548571_986548579 -3 Left 986548571 5:8926814-8926836 CCAGAGGCTGAGAAGGGTACGTG No data
Right 986548579 5:8926834-8926856 GTGGGGGGTCAGGAGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548579 Original CRISPR GTGGGGGGTCAGGAGGAAGT AGG Intergenic
No off target data available for this crispr