ID: 986548662

View in Genome Browser
Species Human (GRCh38)
Location 5:8927644-8927666
Sequence CTTGGGTGCTGGAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986548656_986548662 23 Left 986548656 5:8927598-8927620 CCTGCGTTTTCCTAATGTTGATA No data
Right 986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG No data
986548657_986548662 13 Left 986548657 5:8927608-8927630 CCTAATGTTGATATTTTACATTT No data
Right 986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986548662 Original CRISPR CTTGGGTGCTGGAGGAAAGA AGG Intergenic
No off target data available for this crispr