ID: 986556108

View in Genome Browser
Species Human (GRCh38)
Location 5:9011112-9011134
Sequence TGGACATGGCTCTACCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986556102_986556108 -2 Left 986556102 5:9011091-9011113 CCCTGGTCACCAAGGTGGCAGTG No data
Right 986556108 5:9011112-9011134 TGGACATGGCTCTACCCTATGGG No data
986556103_986556108 -3 Left 986556103 5:9011092-9011114 CCTGGTCACCAAGGTGGCAGTGG No data
Right 986556108 5:9011112-9011134 TGGACATGGCTCTACCCTATGGG No data
986556101_986556108 -1 Left 986556101 5:9011090-9011112 CCCCTGGTCACCAAGGTGGCAGT No data
Right 986556108 5:9011112-9011134 TGGACATGGCTCTACCCTATGGG No data
986556096_986556108 16 Left 986556096 5:9011073-9011095 CCTGGAAACTGGTGCCACCCCTG No data
Right 986556108 5:9011112-9011134 TGGACATGGCTCTACCCTATGGG No data
986556100_986556108 2 Left 986556100 5:9011087-9011109 CCACCCCTGGTCACCAAGGTGGC No data
Right 986556108 5:9011112-9011134 TGGACATGGCTCTACCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986556108 Original CRISPR TGGACATGGCTCTACCCTAT GGG Intergenic
No off target data available for this crispr