ID: 986557960

View in Genome Browser
Species Human (GRCh38)
Location 5:9030345-9030367
Sequence AATCCAGGAGTCGCCTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986557952_986557960 30 Left 986557952 5:9030292-9030314 CCCTGCTGCCCTCTTGCTGTGTT No data
Right 986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG No data
986557953_986557960 29 Left 986557953 5:9030293-9030315 CCTGCTGCCCTCTTGCTGTGTTT No data
Right 986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG No data
986557957_986557960 2 Left 986557957 5:9030320-9030342 CCAATCCATCTCTGTGTTAAGTC No data
Right 986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG No data
986557956_986557960 3 Left 986557956 5:9030319-9030341 CCCAATCCATCTCTGTGTTAAGT No data
Right 986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG No data
986557954_986557960 22 Left 986557954 5:9030300-9030322 CCCTCTTGCTGTGTTTACTCCCA No data
Right 986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG No data
986557958_986557960 -3 Left 986557958 5:9030325-9030347 CCATCTCTGTGTTAAGTCTCAAT No data
Right 986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG No data
986557955_986557960 21 Left 986557955 5:9030301-9030323 CCTCTTGCTGTGTTTACTCCCAA No data
Right 986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986557960 Original CRISPR AATCCAGGAGTCGCCTCACC AGG Intergenic
No off target data available for this crispr