ID: 986561031

View in Genome Browser
Species Human (GRCh38)
Location 5:9061070-9061092
Sequence GGTGAAATCCACCAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986561021_986561031 25 Left 986561021 5:9061022-9061044 CCCAGCTTAAGGGCAGCCTGCTT 0: 1
1: 0
2: 1
3: 6
4: 97
Right 986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 104
986561024_986561031 9 Left 986561024 5:9061038-9061060 CCTGCTTGCTGTGGCTGCCATGA 0: 1
1: 0
2: 4
3: 49
4: 763
Right 986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 104
986561022_986561031 24 Left 986561022 5:9061023-9061045 CCAGCTTAAGGGCAGCCTGCTTG 0: 1
1: 0
2: 1
3: 17
4: 152
Right 986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 104
986561026_986561031 -8 Left 986561026 5:9061055-9061077 CCATGATTTCTCCTTGGTGAAAT 0: 1
1: 1
2: 2
3: 40
4: 451
Right 986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986561031 Original CRISPR GGTGAAATCCACCAAGGGGC TGG Intronic
900489948 1:2942850-2942872 GGTGAAAGACACCCAGTGGCTGG - Intergenic
901455953 1:9362965-9362987 GCTGAAATCTACCGAGGGGGTGG - Intronic
903360339 1:22773043-22773065 GGTGGAGGCCACCTAGGGGCAGG - Intronic
904049686 1:27631795-27631817 GATGAAATCCCCCAGGCGGCTGG - Intronic
905507527 1:38491801-38491823 GTTGAAATCCTGTAAGGGGCCGG + Intergenic
909611175 1:77553277-77553299 GGTGGAATTCAGCAAGAGGCTGG + Intronic
913519340 1:119631032-119631054 GGTTAAATCCACAAAGTGGTGGG - Intronic
916541436 1:165759119-165759141 ATGGAAATCCACCAAGGGGTAGG - Intronic
922562867 1:226581784-226581806 GATGAAATCCACTAAGAGGATGG - Intronic
1063125975 10:3137136-3137158 TGTTAAAACCACCAAGGGGTGGG + Intronic
1063420196 10:5906411-5906433 GGTGAAACCGACCAAGATGCTGG + Exonic
1068388412 10:56360865-56360887 GGAGCAATCTACGAAGGGGCAGG + Intronic
1070687403 10:78498377-78498399 GGTGAAAAGCAACAGGGGGCTGG - Intergenic
1072751818 10:97986161-97986183 GATGAAATGCACCAAGGGCAGGG + Intronic
1073126405 10:101152969-101152991 GGAGAAATTCACACAGGGGCAGG + Intergenic
1077302221 11:1852653-1852675 GGTGAAATCTACCCAGAGGCCGG - Intergenic
1084715758 11:70872523-70872545 GGTGCAAACGACCAAGTGGCTGG + Intronic
1084731177 11:71074672-71074694 GGTGAGGGCCACTAAGGGGCAGG + Intronic
1088194278 11:107258168-107258190 TGTGAAAACCACAAAGGGGACGG + Intergenic
1088430146 11:109750032-109750054 GGTGAAATGGACCAAAGAGCAGG + Intergenic
1089328405 11:117673347-117673369 GGAGAAGTCCACCCAGGAGCTGG - Intronic
1092385581 12:8033512-8033534 GGGGAACTCCCCCAAGGGGGAGG + Exonic
1097068414 12:56337520-56337542 AGTTAAATCTACCAAGGGCCGGG - Intronic
1100679364 12:96901842-96901864 GTTGAAATGCACCATGGGCCAGG - Intergenic
1108495845 13:51024694-51024716 GAAGAAATCCATCAAGGGGGTGG + Intergenic
1109315883 13:60748617-60748639 GAAGAAATCTACCAAGGGGCTGG + Intergenic
1113078977 13:106496603-106496625 GGTGAACACCAGCAAGTGGCTGG - Intronic
1114417927 14:22556660-22556682 GGTGCAAGTCACCGAGGGGCCGG - Exonic
1119751988 14:77085278-77085300 GGAGAAAACGATCAAGGGGCAGG + Intergenic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1130557102 15:84930347-84930369 GGTTTCATCCAGCAAGGGGCAGG + Intronic
1132249851 15:100327533-100327555 TGTGAAATACACCATGGGGGAGG + Intronic
1138122000 16:54407933-54407955 TGTAAAATCCACCCTGGGGCAGG + Intergenic
1144965295 17:19073507-19073529 GGTGAAAGCCAAGAAGGAGCAGG - Intergenic
1144982672 17:19178676-19178698 GGTGAAAGCCAAGAAGGAGCAGG + Intergenic
1144985551 17:19199563-19199585 GGTGAAAGCCAAGAAGGAGCAGG - Intergenic
1148858115 17:50590281-50590303 GAGGAAATGCACCCAGGGGCAGG - Intronic
1152106788 17:78334861-78334883 GGTGAAAGCCAGCAAGAGTCCGG + Intergenic
1153522159 18:5963441-5963463 GGTGGAGGCCACCACGGGGCAGG - Intronic
1154377297 18:13820998-13821020 GCTCAACACCACCAAGGGGCTGG - Intergenic
1155176113 18:23302688-23302710 CGTGCATTCCACCAAAGGGCTGG - Intronic
1159074002 18:63659651-63659673 GGTGAAATACACCAAGTATCAGG - Intronic
1160306860 18:77747990-77748012 GTGGAAGGCCACCAAGGGGCAGG + Intergenic
1166539143 19:43594170-43594192 GGTAAAATCTTCCAGGGGGCTGG + Intronic
1167507645 19:49879307-49879329 GATGAGTTCCACCCAGGGGCCGG + Intronic
926185685 2:10689161-10689183 GCTGAGATCCAGCAAGGGGAAGG - Intronic
926879311 2:17525123-17525145 GGTGAAAAGCAACAAGGGCCTGG + Intergenic
927504077 2:23602048-23602070 GGAGAAACTCACGAAGGGGCAGG + Intronic
929900941 2:46003039-46003061 GGAGAAATTCAAGAAGGGGCAGG + Intronic
930160129 2:48146359-48146381 GGAGAAATCAACTAAGGGCCAGG - Intergenic
932749560 2:74362748-74362770 GGTGAGGCCCACCAAGGCGCAGG + Intronic
935603839 2:104950015-104950037 GGTGAAAACCACCCAGCGGTGGG + Intergenic
936931534 2:117794841-117794863 CTTGAAATTCTCCAAGGGGCGGG - Intergenic
938187899 2:129249282-129249304 GGAGAAATCCACCAGAGGACTGG + Intergenic
938977077 2:136489710-136489732 TCTGAAATCCACCTAGGGGATGG + Intergenic
942176936 2:173343393-173343415 GGTGACACCCACCAAGGGACAGG + Intergenic
944737754 2:202583383-202583405 CAAGAAATCCACCAAGGGCCGGG - Intergenic
948658886 2:239494508-239494530 CATGAAAGCCACCAAGGGGAAGG + Intergenic
948672610 2:239578122-239578144 CGAGCAACCCACCAAGGGGCGGG + Intergenic
1174474153 20:50784030-50784052 GGGCATGTCCACCAAGGGGCAGG + Intergenic
1175311765 20:58017421-58017443 GGTGAAATGCTCAAAGGGACTGG + Intergenic
1179007313 21:37527224-37527246 GGTGAGAACCACCAAGAGGATGG + Intergenic
950391281 3:12698667-12698689 AGGGAAAGCCACCAAGGGCCCGG + Intergenic
950540753 3:13610857-13610879 GATGAACTCCAGAAAGGGGCAGG + Intronic
950899869 3:16487863-16487885 GATGAAACCCATCAAAGGGCAGG + Intronic
951093032 3:18597716-18597738 GGTGAAAGCCACCAGGAGGGAGG - Intergenic
954614875 3:51964417-51964439 GAGGGAATCCCCCAAGGGGCGGG - Intronic
959507742 3:107174849-107174871 TGTGGAAGCCACCAAGGGGTGGG + Intergenic
964369385 3:155983901-155983923 AGTGAAACCCACCTAGGGGAAGG - Intergenic
965077778 3:164001849-164001871 GGACAAATACACCAAGGGGATGG - Intergenic
969640302 4:8394303-8394325 CATGAAATCCACTGAGGGGCGGG + Intronic
969875643 4:10133833-10133855 GGGGGATACCACCAAGGGGCAGG + Intergenic
971301390 4:25445095-25445117 GGGAAAAGCCACCAAGGGGATGG - Intergenic
978003183 4:103582034-103582056 GGTGAATTCTACCTAGGGACCGG + Intergenic
978201030 4:106023792-106023814 GGGCAAATGAACCAAGGGGCTGG - Intergenic
978478641 4:109162412-109162434 GGTGAAATCATCCAAGTGCCAGG + Intronic
982178966 4:152732440-152732462 GAAGAAAAGCACCAAGGGGCTGG - Intronic
983937454 4:173512055-173512077 GGTAAAATCGTCCAAGAGGCTGG + Intergenic
986066084 5:4235847-4235869 ATTAAAATCCACCAAGGGGCTGG + Intergenic
986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG + Intronic
986831268 5:11581553-11581575 AGTGCAATCCATCTAGGGGCTGG - Intronic
986853523 5:11841238-11841260 GCTGAAATTCAACAAGGGGCTGG - Intronic
988263790 5:28926434-28926456 GGTGAAGGCCAAGAAGGGGCCGG + Intergenic
988784291 5:34551657-34551679 GTTAAAATCCAACAAGTGGCCGG - Intergenic
991395613 5:66202195-66202217 GGAGAAACCAACCAAGGGCCAGG - Intergenic
996580362 5:125025582-125025604 GATGGAATCTCCCAAGGGGCAGG + Intergenic
999168709 5:149574489-149574511 GGTGAACACAACCAAGGGGCAGG - Intronic
1001382290 5:171312471-171312493 GGTCAAATCCACCTGGGGGGTGG + Intergenic
1002876782 6:1217760-1217782 GGGGAAGTCCTCCAAGGGCCAGG + Intergenic
1004457210 6:15802226-15802248 GGTGGTATACACCAAGGGACGGG + Intergenic
1004707267 6:18136107-18136129 GGTAAAATCCACCAAGCAGTGGG - Intronic
1004780472 6:18902898-18902920 GGGGAAATCCACAGAGAGGCAGG + Intergenic
1017480582 6:154850487-154850509 GGTGAAATTCACCTACGGGAAGG - Intronic
1018306959 6:162467863-162467885 TGTAAAATCCAGCAAGGGGTTGG - Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019354126 7:570125-570147 GGTGAGATCCGCCGAGGTGCCGG - Intronic
1020329348 7:7002153-7002175 GGTGAAAACCACCTTAGGGCTGG - Intergenic
1028725081 7:94077398-94077420 GGTGGAATCCACTTAGAGGCTGG - Intergenic
1029572374 7:101378814-101378836 GGGGACATCCTCCAAGGGGCTGG - Intronic
1030156955 7:106465158-106465180 GGTGAGATCCACCAGGGTGCAGG - Intergenic
1030415894 7:109241816-109241838 GGAGAATTCCTCCATGGGGCAGG - Intergenic
1030784761 7:113645770-113645792 TGTGAAATCCACCAAGGCTTGGG + Intergenic
1034295643 7:149969923-149969945 CTTGAAATCCCCCAAGGAGCTGG + Intergenic
1034810418 7:154126982-154127004 CTTGAAATCCCCCAAGGAGCTGG - Intronic
1048934081 8:139341009-139341031 GGGGAAAAACACCAGGGGGCAGG - Intergenic
1053310818 9:37018314-37018336 AGTTAAATCCACCCAGGGCCTGG - Intronic
1056655523 9:88505684-88505706 TGAGAAAGCCACAAAGGGGCTGG - Intergenic
1061091351 9:128428354-128428376 GGTGAAATCCCACCAGGGGCTGG + Exonic
1188746480 X:33850885-33850907 GCTGAAAACCACCAAGGGAAAGG + Intergenic
1188979631 X:36715282-36715304 GGTGCAAACAACCGAGGGGCTGG + Intergenic
1189304191 X:39974374-39974396 GGTGGAATGGACCATGGGGCTGG - Intergenic
1190558914 X:51668208-51668230 GGAGAAAAGCACCAAGGGGATGG - Intergenic
1190565377 X:51725114-51725136 GGAGAAAAGCACCAAGGGGATGG + Intergenic
1194450707 X:94041705-94041727 GGTGAAAGCCACCAAGGCTTGGG - Intergenic
1198982811 X:142418793-142418815 GGGGAATCCCACCAAGGGACAGG + Intergenic