ID: 986561660

View in Genome Browser
Species Human (GRCh38)
Location 5:9066377-9066399
Sequence ACTGACCCACTTCCATGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986561660_986561668 19 Left 986561660 5:9066377-9066399 CCCTTCCATGGAAGTGGGTCAGT 0: 1
1: 0
2: 0
3: 16
4: 134
Right 986561668 5:9066419-9066441 ACCATCTGTGGAGCAGCCACTGG 0: 1
1: 0
2: 0
3: 18
4: 212
986561660_986561667 7 Left 986561660 5:9066377-9066399 CCCTTCCATGGAAGTGGGTCAGT 0: 1
1: 0
2: 0
3: 16
4: 134
Right 986561667 5:9066407-9066429 GAATCACTACTCACCATCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986561660 Original CRISPR ACTGACCCACTTCCATGGAA GGG (reversed) Intronic
900970315 1:5989025-5989047 CCTGACCCAATTCCATGTATGGG + Intronic
906275847 1:44514965-44514987 ACTGACCCATTTTCAAGGACTGG - Intronic
906287446 1:44596670-44596692 GCCGACCCACTTCCAAGGCAAGG + Intronic
907952141 1:59193955-59193977 TCTGACCCACATTCATGGGAGGG + Intergenic
910077192 1:83295517-83295539 ATTGACTCACTTCTAAGGAATGG + Intergenic
913464588 1:119126986-119127008 ACTGCCTAACTTCCATGGCATGG - Intronic
915703781 1:157823897-157823919 GCTGACCCACTTCCACAGAATGG + Intergenic
916498295 1:165364983-165365005 ACTGACTCACTTCCAGGCACAGG + Intergenic
916570560 1:166022498-166022520 CCTGACTAACTTCCATGGCATGG + Intergenic
916936161 1:169630290-169630312 CCAGACCATCTTCCATGGAAGGG - Intergenic
918308254 1:183266785-183266807 CCTGACTCACTTCCATGGCCTGG + Intronic
919950793 1:202361479-202361501 ACTCACTCATTGCCATGGAAAGG + Intronic
921033857 1:211357591-211357613 ACCCACCCACTTCTATGGTAAGG + Intronic
921905675 1:220493326-220493348 AAGGACCCAGTTCCAAGGAAGGG - Intergenic
922543762 1:226438844-226438866 CCTGACTAACTTCCATGGCATGG + Intergenic
923051128 1:230392263-230392285 ACTGACCCACGGCCCTGGAGGGG + Intronic
1066462466 10:35623966-35623988 ACTCACTCACTACCATGGAAGGG + Intergenic
1067922265 10:50471439-50471461 ACACAACCACTTCCATGGTAGGG + Intronic
1068734503 10:60397368-60397390 ACTGACTTCCTGCCATGGAAAGG + Intronic
1072458172 10:95594875-95594897 ACTGCCTAACTTCCATGGCATGG + Intergenic
1074932701 10:118145335-118145357 CCTGACCCAATTCCAAGGCAGGG + Intergenic
1076082719 10:127598236-127598258 ACTGACCCATTTGTAAGGAATGG + Intergenic
1076853154 10:133102954-133102976 ACTGACCCTCCCCCATGGACCGG - Intronic
1077757417 11:5047653-5047675 ACTGACCAACTATCCTGGAAGGG + Intergenic
1079603342 11:22338186-22338208 GCTGACCGACTTCCAGGAAAAGG + Exonic
1085296101 11:75432632-75432654 ACTGACACACTTCCTAGGAGGGG - Intergenic
1086492027 11:87365185-87365207 ACTGACCCACTTCCTTTGGTTGG + Intergenic
1094005314 12:25742916-25742938 ACTGGCCCTCTTCCATGTGAGGG - Intergenic
1095883423 12:47163983-47164005 ACTCACCCACTCCTATGGAAGGG + Intronic
1097293829 12:57942321-57942343 CATGAACCACTTCCAAGGAACGG - Intronic
1097481446 12:60131415-60131437 AGTGACCTAATTTCATGGAATGG - Intergenic
1098275058 12:68804764-68804786 ACTGTCCCAAGTCAATGGAAAGG - Intergenic
1101241660 12:102845084-102845106 ACTGCCCCAGTGCCATGGACAGG + Intronic
1101956909 12:109220022-109220044 ACAGACCCACTGCCTTTGAATGG - Intronic
1104931227 12:132340494-132340516 ACTCACCCACTGCCAAGGGAGGG - Intergenic
1106159338 13:27186481-27186503 AATGAATCACTTCCATGGAACGG - Intergenic
1114518229 14:23315210-23315232 GCTACCCCACTTCCATGCAAAGG + Intronic
1118930828 14:70238759-70238781 ACTGACCCATTGCCAGGGATAGG - Intergenic
1119988427 14:79167286-79167308 ACTGACCCACTTACATGTTATGG + Intronic
1122808487 14:104275464-104275486 ACTGGCCCACAGCCAAGGAAAGG - Intergenic
1123197231 14:106628199-106628221 AATGACCCACTTCCAGGGACAGG - Intergenic
1123198575 14:106640075-106640097 AATGACCCACTTCCAGGGACAGG - Intergenic
1202947312 14_KI270726v1_random:40889-40911 AATGACCCACTTCCAGGGACAGG + Intergenic
1125872647 15:43116184-43116206 CCTGACTAACTTCCATGGCATGG - Intronic
1125920392 15:43522031-43522053 ACTGACCCTCTTCCACAAAATGG + Exonic
1127523486 15:59768639-59768661 CCTGACTAACTTCCATGGCATGG + Intergenic
1127805173 15:62512688-62512710 ACTGACTTACTTCAATGCAAGGG - Intronic
1128603814 15:69019266-69019288 ACTGCCCACCTGCCATGGAAGGG + Intronic
1131804812 15:96110127-96110149 ACTGGGCCACTTCCATGGCAAGG + Intergenic
1133065256 16:3201822-3201844 ACTGAGTCATTGCCATGGAAAGG - Intergenic
1133922657 16:10167597-10167619 ACATAGCCACCTCCATGGAAGGG + Intronic
1135223361 16:20634113-20634135 ACTGACCTTTCTCCATGGAATGG - Intronic
1137406863 16:48196167-48196189 TCTGACCCAGTTCCAGGGATAGG + Intronic
1139016535 16:62696318-62696340 ACAAAGCCACTTCTATGGAAGGG + Intergenic
1142162604 16:88566380-88566402 ACTGAGTCATTGCCATGGAAAGG - Intergenic
1143281071 17:5754513-5754535 ACTGACTCAGTTTCATAGAAAGG - Intergenic
1144178158 17:12728435-12728457 ACTGGCCCAGTCCCATGAAAAGG - Intronic
1154004794 18:10517791-10517813 TCTGACCCTCTTCCATTGAGAGG - Intergenic
1155522679 18:26685057-26685079 ATTCACCAGCTTCCATGGAATGG - Intergenic
1158697874 18:59718770-59718792 ACTGACCCAGATTCATGGAGAGG - Intergenic
1158741695 18:60149858-60149880 ACTGCCTAACTTCCATGGCATGG + Intergenic
1161333889 19:3700649-3700671 ACTGACCTAATACGATGGAATGG - Intergenic
1164896472 19:31881717-31881739 ACTCACTCATTACCATGGAAAGG + Intergenic
1166573335 19:43813607-43813629 ACTGACTTACTTTCATGGGATGG + Intronic
929503922 2:42513551-42513573 AGAGACCCAGCTCCATGGAATGG + Intronic
931985241 2:67735618-67735640 TCAAACTCACTTCCATGGAATGG - Intergenic
932601524 2:73129955-73129977 CCTTTCCCACTTCCATGAAAAGG - Intronic
939689382 2:145238911-145238933 TCTGACACAATTCCATGGCATGG + Intergenic
940249270 2:151656362-151656384 TCTTAGCCACTTGCATGGAATGG + Exonic
940448595 2:153809630-153809652 ATAGACCCACTTCAATGGACTGG - Intergenic
940952383 2:159690015-159690037 ACTGCCCAACTTCCATGTCATGG - Intergenic
941584252 2:167337027-167337049 CCTGCCCCTCTTCCATGGAGGGG + Intergenic
943112604 2:183624533-183624555 AGTGAGTCACTTCTATGGAAAGG + Intergenic
948644453 2:239395087-239395109 ACTGTTCCCCTTCCTTGGAATGG - Intronic
1169669181 20:8076055-8076077 ACTGATACTCTTCTATGGAAGGG + Intergenic
1171020651 20:21581607-21581629 ACTCACTCACTCCCATGGGAGGG + Intergenic
1173466384 20:43285318-43285340 TCTGAGTCACTGCCATGGAAAGG + Intergenic
1174202432 20:48816376-48816398 ACAGTCCCACTTACATGAAATGG - Intronic
1175608991 20:60334503-60334525 CCTGACCCACACCCAGGGAAAGG - Intergenic
1179599301 21:42465402-42465424 TTTGACCCACTTCCTTGTAAGGG - Intergenic
1181977837 22:26743980-26744002 ACTCATTCAATTCCATGGAAAGG - Intergenic
1182519305 22:30876406-30876428 ACCGCCCCACTGCCCTGGAAAGG + Intronic
1182895541 22:33856280-33856302 TCTGACCCTCTTCCATGGAGAGG - Intronic
1184654360 22:45933651-45933673 ACTGACCTACCTCCGTGGAGTGG + Intronic
953676671 3:45007945-45007967 ACTCACCCACTTCTAGGGACAGG - Intronic
953988538 3:47465134-47465156 ACTTTCCCACTTTCATGGATTGG + Intronic
955161884 3:56471468-56471490 ACAGACCAACTTCCTTGGCAAGG - Intergenic
955375990 3:58397706-58397728 ACTGACCCACAGCCATGGACGGG - Exonic
956400616 3:68875566-68875588 CCTGTCCCACTTCCAGTGAATGG - Intronic
958657117 3:97017246-97017268 ACACAGCCACTTCCAGGGAATGG - Intronic
964442033 3:156721853-156721875 ACAGACCCACTCCCAAGTAAAGG + Intergenic
965304141 3:167043023-167043045 ACTGGCCCATCCCCATGGAAAGG + Intergenic
966469791 3:180276286-180276308 ACTCACTCATTTCCATGCAAGGG + Intergenic
969831018 4:9796956-9796978 AGTACACCACTTCCATGGAAAGG + Intronic
970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG + Intergenic
970553118 4:17204179-17204201 ACTGAGCCACTTCTAGGGTAGGG - Intergenic
971111128 4:23587220-23587242 ACTGACCTAGTTGCATTGAAGGG - Intergenic
974016311 4:56652473-56652495 AGTGACCCTTTCCCATGGAAAGG + Intronic
975377479 4:73662672-73662694 ACTGACCCACTTCCAGCTCAGGG - Intergenic
976794495 4:88917333-88917355 ACTCACTCACTTCCAAGGGAGGG + Intronic
978394404 4:108263150-108263172 ACTGACAAACTTCCATGTTAGGG + Intergenic
979531229 4:121771088-121771110 CTGGACCCACTTCCCTGGAACGG - Intergenic
982010475 4:151101096-151101118 CCTGACTAACTTCCATGGCATGG + Exonic
986561660 5:9066377-9066399 ACTGACCCACTTCCATGGAAGGG - Intronic
991448756 5:66729119-66729141 ACTGACCCATTTGAAAGGAAGGG + Intronic
992695700 5:79284613-79284635 ACTGCCTAACTTCCATGGCATGG - Intronic
993477417 5:88382225-88382247 CCTGACTAACTTCCATGGCATGG + Intergenic
995078757 5:108020028-108020050 ACTGACCATCTACCATGGATGGG - Intronic
995352272 5:111192733-111192755 CCTGAGCAACTTCCATGGCATGG - Intergenic
995470748 5:112499635-112499657 ACAGACCAACTCCCATGGAGAGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997259927 5:132457854-132457876 ACTGACCCACATCCAAAAAATGG + Intronic
998669925 5:144341937-144341959 ACTGAAAAACTTCCATGAAATGG - Intronic
1001950564 5:175813842-175813864 TCTGAGCCTCTTCCTTGGAAAGG - Intronic
1002887144 6:1307732-1307754 ACTGACGCACATCCTTGGAGAGG - Intergenic
1003667101 6:8121578-8121600 ACTCACTCACCTCCAAGGAAGGG - Intergenic
1010198972 6:73266513-73266535 ACTGTCCCTCCTCCATCGAATGG - Intronic
1013709890 6:112884786-112884808 ACTGACCAACTGCCATGTTAAGG - Intergenic
1016845641 6:148565627-148565649 ACTCACCCACTTCTAAGGGATGG + Intergenic
1017969018 6:159294112-159294134 ACTGAACCACTTAAATGAAATGG - Intergenic
1027294963 7:76760730-76760752 ATTGACTCACTTCTAAGGAATGG + Intergenic
1027569273 7:79843442-79843464 CCTGACCCTCTTCCATGTACTGG + Intergenic
1029137720 7:98386279-98386301 ACTGCCTAACTTCCATGGCATGG - Intronic
1031675876 7:124611034-124611056 ACTCTCCCACTTCTATGGATGGG - Intergenic
1031682742 7:124694694-124694716 ACTCACTCATTTCCATGAAAGGG + Intergenic
1032675145 7:134123183-134123205 CCTGACCCAGTACCATGGAGAGG - Intergenic
1032947181 7:136868397-136868419 ACTCACACACTTGCAGGGAAGGG + Intergenic
1033076933 7:138258448-138258470 ACTGAGTCACTTCCTGGGAAGGG - Intergenic
1035566658 8:645578-645600 CCTGACCCACTTCCAGGGTGTGG + Intronic
1036729348 8:11248647-11248669 ACTGACCAAGTTCCATGGGAGGG - Intergenic
1036963495 8:13271369-13271391 TCTGGCCCACTTCCAAGGAAGGG - Intronic
1040651770 8:49457085-49457107 ACTGACTCATCTCCATGGGAAGG - Intergenic
1043852950 8:85235083-85235105 GCTGACCCTCTTCCAAGTAAGGG + Intronic
1045804465 8:106141279-106141301 ACTAACCCACTTCCATGATAAGG - Intergenic
1048944058 8:139428227-139428249 ACTGTACCAATTCCATGGTATGG + Intergenic
1049508674 8:143017286-143017308 ACTGAGCCCCTGCCATGGCAGGG + Intergenic
1052076916 9:24154256-24154278 ACAGCCCCTCTTCCATGGATGGG - Intergenic
1053688674 9:40568528-40568550 ACTAATCCAGTTCCATGAAAAGG + Intergenic
1056077974 9:83061240-83061262 AGTGACTCACTGCCATAGAAGGG - Intronic
1056425339 9:86469887-86469909 TCTGACTCTCTTGCATGGAAGGG + Intergenic
1057937114 9:99249536-99249558 AGTGACCCCTGTCCATGGAAAGG + Intergenic
1057937138 9:99249646-99249668 AGTGACCCCTGTCCATGGAAAGG + Intergenic
1185754235 X:2640596-2640618 ACCAACCCAATTCTATGGAAAGG - Intergenic
1186047743 X:5554210-5554232 TTTGACCCACTTCCTTGTAATGG + Intergenic
1186734277 X:12444791-12444813 ACTAACCCACTCCCATGATAAGG + Intronic
1188060916 X:25600803-25600825 ACTGACTCAATTCCAATGAATGG + Intergenic
1190050620 X:47146107-47146129 ACTGACGCTCATCCATGGAAAGG + Intronic
1192215868 X:69157667-69157689 CCTTAGGCACTTCCATGGAAGGG + Intergenic
1193709730 X:84864135-84864157 AGTGATCCACTTACATGGATTGG + Intergenic
1193772889 X:85608636-85608658 AGTGACCCACGTCCAGGGAAAGG + Intergenic
1200922062 Y:8622080-8622102 ATTCACCCACTTCTATTGAAGGG + Intergenic