ID: 986567857

View in Genome Browser
Species Human (GRCh38)
Location 5:9133148-9133170
Sequence TTTTTAACTGAAATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 376}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986567857 Original CRISPR TTTTTAACTGAAATGGAACA AGG (reversed) Intronic
901514631 1:9736679-9736701 TCTTAAACTGAAAAGGAAAAGGG + Intronic
901538652 1:9900388-9900410 TTTTTAAATGAAGTGGAATGCGG + Intronic
904867829 1:33595803-33595825 TTTTCCACTAAAATGGACCAGGG - Intronic
907966901 1:59340470-59340492 CTTTGAAAGGAAATGGAACATGG + Intronic
908970027 1:69816651-69816673 TTTTTAAATTAAATAGAAAATGG - Intronic
912337925 1:108880084-108880106 ATTCTAACTGAAAAGGACCAGGG - Intronic
913018049 1:114759098-114759120 TTTTGAACAGAAATGGGACACGG - Intergenic
914851174 1:151315449-151315471 TTTATCAGTGAAATGAAACAGGG + Intronic
916967595 1:169967324-169967346 ATTGTCACTGAAATGGAAAAGGG - Intronic
917871369 1:179244907-179244929 CTTTTGACAGAAATGGAAGAAGG + Intergenic
918914686 1:190619835-190619857 TTTATAACTGAAATAGATAAGGG + Intergenic
919719205 1:200813796-200813818 TTTTTAACTTAAAGGGAATGAGG + Intronic
920759265 1:208766342-208766364 TCTTTAAATGATATTGAACAAGG - Intergenic
921123458 1:212156731-212156753 TTTTTAATTGAAGTGTAATACGG + Intergenic
921360329 1:214325870-214325892 TTTATAACTGAAATGAACTATGG + Intronic
921518390 1:216126638-216126660 TATCTAACTGAAATAGAATAAGG + Intronic
922089257 1:222379958-222379980 TTTTTCAGTGAAATGAAGCATGG - Intergenic
923810246 1:237307395-237307417 TCTTAAACTGAAAAGGAACAAGG + Intronic
924075121 1:240325647-240325669 GTTCTTACTGAAATCGAACAAGG + Intronic
1062777945 10:170515-170537 TTTGTAAGTGAAATGGCACAAGG + Intronic
1062838691 10:652796-652818 TTTTAAACAGAAATGGCACCAGG + Intronic
1062840310 10:665354-665376 TTTTTAACTGAAAAGAAAAACGG + Intronic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1063854524 10:10233796-10233818 TTTTTAACTGAGAGGGAAAATGG - Intergenic
1064150959 10:12864475-12864497 TTATCAACTAAAATTGAACACGG - Intergenic
1068313446 10:55309797-55309819 TTTTAACCTGAAGTGGGACATGG - Intronic
1068314046 10:55319340-55319362 TTGTTAACATAAATGGAACAAGG + Intronic
1068693005 10:59937150-59937172 TGTTTAACTCAAATTGAACCAGG + Intergenic
1068794423 10:61062953-61062975 TTTTTAATTGAAAAGTAATACGG - Intergenic
1069457576 10:68565067-68565089 TTTTTATCAGAAATGAAAAATGG + Intronic
1069641553 10:69959119-69959141 TTATTAAAGGAAATGAAACATGG + Exonic
1070094033 10:73318952-73318974 TGTTTTACTGAGATGGAGCAAGG + Intronic
1071792695 10:88972229-88972251 ATTTAAAATGAAATGAAACAAGG + Intronic
1072326322 10:94302218-94302240 TTCTTAACTGAAATCTAACTTGG - Intronic
1073416612 10:103388850-103388872 GTTTTAGCTGAAGTAGAACATGG - Exonic
1073582305 10:104679891-104679913 TTTTTAATTAAACTGAAACATGG + Intronic
1074220200 10:111429345-111429367 TTTTTAAGTGACATATAACAAGG + Intergenic
1075073453 10:119334388-119334410 TTTTCAACAGAACTGGCACAGGG + Intronic
1075353666 10:121750287-121750309 TTCTTAGATGAAATGGCACATGG - Intronic
1076255431 10:129020508-129020530 TTTTTAAGTGACAAAGAACATGG + Intergenic
1078888627 11:15532361-15532383 TTTTTCACAGAAATAGAAAAAGG + Intergenic
1079025177 11:16941378-16941400 TTTTTCTCTGAAAAGGAAGATGG + Intronic
1079259715 11:18866726-18866748 TGTTTGACTGAAAAGGAAAATGG - Intergenic
1079794400 11:24781604-24781626 TTTTTAAAGAAAATGGAAAATGG - Intronic
1082909302 11:58352314-58352336 TTTTCAGCTGAAATAGATCATGG + Intergenic
1082995718 11:59253472-59253494 TTTTTAAATGGAAGGGAAAAAGG - Intergenic
1083959198 11:66004651-66004673 TTTTTAACTTAATAGGGACAGGG + Intergenic
1085497986 11:76989802-76989824 TTTTTAAATGACATGGTACAGGG - Intronic
1085577364 11:77618686-77618708 TTCTGAAATGAAATAGAACAGGG + Intronic
1085961335 11:81466131-81466153 TTTTAGATTGACATGGAACATGG - Intergenic
1086517293 11:87627419-87627441 TTTCTCACTGAAATTGAAAAAGG + Intergenic
1086942725 11:92815170-92815192 TTCTGAAATGAATTGGAACAAGG + Intronic
1088015909 11:105059815-105059837 CTTTTTACTTAAATGGAAAAGGG + Intronic
1088102697 11:106172529-106172551 TTTTTAAAGCAAAGGGAACAAGG - Intergenic
1089370805 11:117955098-117955120 TTTTGAACTCAAATGGATCTGGG + Intergenic
1089863726 11:121613548-121613570 TTTTTAACTGAAAGTCTACAAGG + Intronic
1090158944 11:124471026-124471048 TTTTCGTCAGAAATGGAACAGGG + Intergenic
1093083727 12:14843369-14843391 TTTTTAATTGAAAAGTAACTTGG - Exonic
1093581766 12:20791469-20791491 GTTGTTACTGAAATGGAGCAAGG - Intergenic
1093699448 12:22202321-22202343 TTTTTGCCTGAAATGGAAAACGG + Intronic
1096499876 12:52058275-52058297 TTTTTCACTTAAATTGCACAGGG + Intronic
1096899525 12:54860556-54860578 TTTCTAGCAAAAATGGAACATGG - Intergenic
1097207413 12:57334665-57334687 TTCTTTACTGAAATTCAACAAGG - Intronic
1097325716 12:58274298-58274320 TTTTTAACATAAATGTAACTCGG - Intergenic
1097800080 12:63904248-63904270 TATATAACTGCAAGGGAACATGG - Intronic
1098079172 12:66765795-66765817 TCTTTCACTGAAATAGAGCAAGG - Intronic
1098332662 12:69370619-69370641 TTTTTAACTGAAATAGAGACTGG - Intronic
1098726105 12:73969812-73969834 TTTTTAAGTGAAAAGTAAGAAGG + Intergenic
1099390619 12:82074418-82074440 TTTTTAACTGACATGTAACTGGG - Intergenic
1099428801 12:82555808-82555830 TTTCTAAGTCAAAGGGAACATGG - Intergenic
1099499821 12:83400214-83400236 ATTTTATGTGAAATGGAAGAAGG + Intergenic
1100686183 12:96988442-96988464 TTTTGAGTTGAAATGGAAGAGGG - Intergenic
1100710820 12:97254679-97254701 TTATGATCTGAAATGAAACAAGG + Intergenic
1100721062 12:97358624-97358646 TTTTAATTTGAAATGGAACTGGG - Intergenic
1100751312 12:97701318-97701340 ATTTTAACAGCAATGGAACATGG + Intergenic
1101133683 12:101716301-101716323 TTTTTAAGTGAAATTGACCTGGG + Intronic
1101136778 12:101752002-101752024 TTTTTAACTTAACTGTAACATGG - Intronic
1102287756 12:111673000-111673022 TTTTTACCTGAACTGGCAGAAGG + Intronic
1103295358 12:119881732-119881754 TTTTAAACTGAAATGGAGGCCGG + Intergenic
1104154032 12:126113497-126113519 TTTTCACCTTAGATGGAACAAGG + Intergenic
1105398465 13:20064405-20064427 ATTTTAAATGAAATAGCACAGGG - Intronic
1105943099 13:25169112-25169134 TTTTTAACTGGAAAGGAAAGAGG + Exonic
1105951664 13:25234727-25234749 TTTAGAACTGTAAAGGAACATGG + Intergenic
1106156659 13:27164250-27164272 TTCTTAACTGAAATGCTTCATGG - Intronic
1107198933 13:37690191-37690213 TATTTAATTTAAATGAAACAGGG + Intronic
1107326561 13:39249916-39249938 TTTTTATCTGACACGGAATATGG - Intergenic
1107716846 13:43208594-43208616 TTTTTCATTGAAATGGTAAAAGG - Intergenic
1108129663 13:47284457-47284479 TTATTTACTAAAAGGGAACAAGG + Intergenic
1109844057 13:67960355-67960377 TTCTCAACTGAAATGGAATATGG + Intergenic
1110093065 13:71478730-71478752 TTATCAACTGAAATTGAAAATGG - Intronic
1110240074 13:73257129-73257151 TTTTCAAATGAAATGAGACAAGG - Intergenic
1110345710 13:74445569-74445591 TTTGTGATTCAAATGGAACAAGG - Intergenic
1111090218 13:83436707-83436729 ATTTTGGTTGAAATGGAACAAGG + Intergenic
1111186581 13:84744776-84744798 TTTTTTGCTTAAATGTAACAAGG + Intergenic
1111361067 13:87177399-87177421 ATTTTAATTAAAATAGAACATGG - Intergenic
1111561752 13:89959406-89959428 ATTTCAACTGAAATGAAAAAAGG + Intergenic
1112671657 13:101646299-101646321 TTTTTAACTGAAATACAACAAGG - Intronic
1113227489 13:108175489-108175511 TTTGTAAATGAAAAGTAACAAGG - Intergenic
1113510300 13:110848781-110848803 TTTTCAACAGAACTGAAACAAGG - Intergenic
1115782740 14:36787695-36787717 TTTCTAACTGAAATATAATAAGG + Intronic
1116294060 14:43082403-43082425 TTTTTAAATGAAATTAGACATGG - Intergenic
1116297598 14:43133420-43133442 TTCTCAGCTGAAATGGAACAAGG + Intergenic
1116309652 14:43307725-43307747 TTCGCAACTGAAATTGAACAAGG + Intergenic
1116641029 14:47463217-47463239 TTTTTCAGTGGAATGGGACAAGG - Intronic
1116883292 14:50193530-50193552 TTTTTAACTGTAAAGAAATAGGG + Intronic
1117923551 14:60751269-60751291 TTTTTTACTGTAATGCAACTGGG + Intronic
1118121364 14:62847783-62847805 TCTTTAACTGCAAATGAACAAGG + Intronic
1118727829 14:68642456-68642478 TTAATAACAGAAATGAAACAGGG - Intronic
1118864662 14:69693446-69693468 CTTATTACTGAACTGGAACAAGG + Intronic
1118920646 14:70146646-70146668 TTCATAGCTGAAGTGGAACAAGG + Intronic
1119163640 14:72474036-72474058 TTTCCCACTGAAATTGAACAAGG - Intronic
1119350748 14:73962850-73962872 TTTTTAGCTGAAATAAAACAAGG + Exonic
1119549666 14:75499320-75499342 TTTTTAAGTCAACTGGAACCTGG + Intergenic
1119980527 14:79075865-79075887 TTTTTGAGAGAAATGGAAAATGG + Intronic
1120349638 14:83338464-83338486 ATTTTAACGAAAATAGAACAAGG + Intergenic
1120754790 14:88232679-88232701 TTTCTAAATTAAATAGAACAAGG + Intronic
1121976486 14:98408804-98408826 TTCTGAACTGAAATGTCACAGGG - Intergenic
1124071691 15:26400605-26400627 TTTTGTACTGATCTGGAACATGG + Intergenic
1124830176 15:33141275-33141297 TTTTGAACTGAAATGTGAAAAGG - Intronic
1124870975 15:33542229-33542251 TTCTTAACTGAAATCTATCAGGG - Intronic
1125107320 15:35987792-35987814 TTTGTCACTGAAATGAAAAATGG - Intergenic
1126003487 15:44233956-44233978 TAATTACCTGAAATGGAATAAGG - Intergenic
1126308153 15:47284730-47284752 TTTCTAGCAGAAATGGGACAAGG + Intronic
1126920569 15:53518040-53518062 TTTTTAACTGCCAAGGAAGATGG + Intronic
1127030671 15:54858539-54858561 TTTTTCACTGAAATGCAGCTAGG - Intergenic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127341300 15:58047210-58047232 TTTATTACTGAAATAAAACATGG - Intronic
1127840225 15:62825254-62825276 TGTTTGACTGAAATGGCAAATGG + Intronic
1130238315 15:82160652-82160674 TTTTTAACTAATATGGATAAAGG + Intronic
1130817377 15:87452070-87452092 TTTTTCAGAGAAATGGACCATGG + Intergenic
1131078098 15:89511344-89511366 TTTGTCCCTCAAATGGAACAAGG + Intergenic
1131650881 15:94398287-94398309 TTTTTAACAGAAATGAATAAAGG - Intronic
1132338488 15:101063793-101063815 TTTTTAAATGAAACTGAAGAAGG - Intronic
1132393065 15:101453009-101453031 TTTTTAATTGTAATAAAACAAGG + Intronic
1132862396 16:2078110-2078132 GTTGTAGCTGAAAGGGAACAAGG + Intronic
1133591381 16:7247682-7247704 AATTTAGCTGAAATGGAATACGG + Intronic
1133979031 16:10619880-10619902 TTTTTTCCAGAAATGGAATAGGG - Intergenic
1134215247 16:12312153-12312175 TTTTTAACTCAAAGGCAAAAAGG + Intronic
1135907264 16:26524410-26524432 TTTTAAACTGATATGGTACTAGG - Intergenic
1135979628 16:27137378-27137400 TCTTTAACTGAGATAGAGCAGGG - Intergenic
1138079532 16:54076753-54076775 TTTTCAAATGAAATGATACAGGG - Intronic
1138669228 16:58599545-58599567 TTTTTAAATTAAAAGGAAAAAGG + Intronic
1140240753 16:73197822-73197844 TTTATACCTGAAATAAAACAGGG - Intergenic
1140567566 16:76061948-76061970 TTTTTAAATGTCATGGAATAAGG - Intergenic
1141015151 16:80441852-80441874 TTTTTAACTCCAAAGCAACAGGG + Intergenic
1142297645 16:89236705-89236727 TTTGCCACTGAAATGGAGCACGG - Exonic
1144023463 17:11257222-11257244 TTTTTAACAAACATGGACCAAGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1149505845 17:57193287-57193309 TTTTTAGCTAGAATGGCACATGG + Intergenic
1149670550 17:58404865-58404887 GTTTTAACTAAAATTTAACAGGG + Intronic
1149730487 17:58941380-58941402 TTTTTAAAGGAAATAGAATAAGG - Intronic
1151034984 17:70788377-70788399 TTTATAATTGAAATTGAACTTGG + Intergenic
1152005329 17:77676821-77676843 TTTTTAACTGAAATATGAAATGG + Intergenic
1153106416 18:1533280-1533302 TATGTACCTAAAATGGAACATGG - Intergenic
1155587784 18:27387583-27387605 TTTTTACCTCCAATGAAACAAGG + Intergenic
1155732038 18:29172733-29172755 TTATTCACAGAAACGGAACAAGG + Intergenic
1155766806 18:29645161-29645183 TTCATTACTGAAATGAAACAAGG - Intergenic
1155841026 18:30642854-30642876 TTCTTCAATGAAAAGGAACAAGG + Intergenic
1157264331 18:46204787-46204809 GTTTCAACTGAAAAGGAAAAGGG + Intronic
1158092695 18:53733563-53733585 TTTTTATCTGGAATTGAAGAGGG - Intergenic
1158230193 18:55246094-55246116 TTTTTAAATGAACTGTTACAGGG - Intronic
1158842644 18:61404738-61404760 TTTTTAACTGCCAAGGAAAAGGG - Intronic
1158944406 18:62436293-62436315 TTAGTAGCTGAAAGGGAACAAGG - Intergenic
1159407351 18:68021819-68021841 TTTTTAACTGAGGAGGAAAATGG + Intergenic
1159943073 18:74424069-74424091 TCTTTAACGAAAATGGAACTGGG + Intergenic
1160047063 18:75396238-75396260 GTTTTAACTGAAATGTCTCATGG + Intergenic
1164825349 19:31281198-31281220 TTCTGATGTGAAATGGAACAGGG - Intronic
1165814011 19:38630163-38630185 TTTTTTTCTGAAATGGAGTATGG + Intronic
1167034632 19:46987789-46987811 TTTTTAAGTGAAAAAGAAAATGG + Intronic
1168635297 19:57991499-57991521 TTTTTTATTTAAATGTAACATGG + Intronic
925239728 2:2313523-2313545 TTTTTAATGGAAATGGTATAAGG + Intronic
925973743 2:9126235-9126257 TCTTTACCTGAAACGTAACAAGG + Intergenic
927163863 2:20297373-20297395 TTTTCAACTGTAATGCTACAGGG - Intronic
927186804 2:20487962-20487984 ATCTTAACTGAAATGGAGAAGGG + Intergenic
927759052 2:25734705-25734727 CTGTTAAGTGAAATGGAACTTGG - Intronic
928462484 2:31488071-31488093 TTTTTAAATGAAATGCTACATGG - Intergenic
929424270 2:41827934-41827956 TTTTTTTCTGCAGTGGAACAAGG - Intergenic
930354627 2:50301999-50302021 TTTTTCAGTGGAATGGAAAAAGG + Intronic
931635647 2:64338649-64338671 TTTTTAATATAAATGGGACAGGG - Intergenic
932078606 2:68690408-68690430 TTACCAACTGAAATGGAAAAAGG + Intronic
932929256 2:76014330-76014352 TTGTTAACTGAAATAGCCCATGG + Intergenic
933448377 2:82412625-82412647 TTTTGAAGTGAAAAGGAAAAAGG + Intergenic
934138255 2:89018700-89018722 TTTTTAACTGAAACTTAGCATGG - Intergenic
934143364 2:89069780-89069802 TTTTTAACTGAAACTTAACATGG - Intergenic
934225876 2:90130775-90130797 TTTTTAACTGAAACTTAACATGG + Intergenic
934230993 2:90181926-90181948 TTTTTAACTGAAACTTAGCATGG + Intergenic
937270642 2:120649298-120649320 TTTTTCACTGAAAGGGAACTAGG - Intergenic
940381692 2:153022071-153022093 TAATGAACTGAAAAGGAACAGGG + Intergenic
940418555 2:153451672-153451694 TTTTGAACTAAAACGGAACTTGG + Intergenic
940623996 2:156149909-156149931 TTTTTAGCTGAAATTTAAGAAGG - Intergenic
940799449 2:158117282-158117304 TTTTAAACTTAAACTGAACATGG - Intronic
941235794 2:162971479-162971501 TCTATAACTGAAATAAAACAAGG + Intergenic
941460199 2:165761595-165761617 TTTTTAACAGAAAAGAAACATGG + Intronic
941500701 2:166272121-166272143 TTTTCAACTGACAGGAAACATGG + Intronic
942533424 2:176937101-176937123 TTTTCAGTTGAAATTGAACAAGG + Intergenic
942962435 2:181847938-181847960 TTTTTTTCAGAAATGGAAAAAGG + Intergenic
944055605 2:195519182-195519204 ATTTTAAAAGAATTGGAACAAGG + Intergenic
944286913 2:197961104-197961126 ATTTCTACTGAAATGGAATATGG - Intronic
944959331 2:204852795-204852817 TATTTAATTGAGATGGAATAGGG + Intronic
945427194 2:209720953-209720975 TTTTAAACTGATCTGGAATATGG + Intronic
945779257 2:214147704-214147726 TTTATGACTTAAAAGGAACATGG - Intronic
945960245 2:216126050-216126072 TTTTTAACAGAAATGTTACCAGG + Intronic
947979151 2:234394480-234394502 ATTTAAAGTGAAATGGAAGATGG + Intergenic
948371206 2:237490090-237490112 ATCTAAACAGAAATGGAACAAGG + Intronic
948988023 2:241537494-241537516 TTTTTTTCTAAAATGGAAAAAGG + Intergenic
949078593 2:242078398-242078420 TTTTTAGCTGAAATGAAAAGTGG + Intergenic
1170399327 20:15962834-15962856 TATTTACCTGAAAGGTAACAGGG - Intronic
1171263439 20:23751995-23752017 TTTGGAAGTGAAATAGAACAGGG + Intergenic
1171368904 20:24647711-24647733 TTTTTATCTCAAATGAAAAAGGG - Intronic
1171479896 20:25446399-25446421 TTTTTAAATGAAAGTAAACATGG + Exonic
1172115160 20:32569363-32569385 TTTTGAACAGAGAAGGAACATGG + Intronic
1174018212 20:47506399-47506421 TTTTTAAATGAACAGGAAAATGG + Intronic
1175085009 20:56451097-56451119 GTTTTACCTCAAATGCAACAAGG - Intronic
1176878689 21:14165434-14165456 TTTTTAAATGTACTTGAACATGG - Intronic
1177531506 21:22363886-22363908 TATTTGACTGAAATGGGAAATGG + Intergenic
1178254025 21:31034239-31034261 TTTAAAACAGAAATGGAGCAAGG + Intergenic
1179074555 21:38107611-38107633 TTTTTCACAAAATTGGAACAGGG - Intronic
1181948042 22:26533606-26533628 TTTTAAAATAAAATGAAACAAGG + Intronic
1185132644 22:49048179-49048201 TTTTTAAATGGAATCAAACAGGG - Intergenic
951179211 3:19639205-19639227 ATTTTAAATGAAATTAAACAGGG + Intergenic
951397217 3:22183759-22183781 TTTATAATTAAAATGGAACTTGG + Intronic
952056736 3:29455908-29455930 TTCTTATCTGAGATAGAACAAGG - Intronic
954084621 3:48234263-48234285 TTTTAAACTGCAATGGAAAAGGG + Intergenic
954850029 3:53592366-53592388 TTTTTAATTGGAATGGAGTAGGG + Intronic
955972909 3:64453475-64453497 TTCTTAACTGGAATAAAACAAGG + Intergenic
957503869 3:81094634-81094656 TTTTTAACCTAAGTGTAACATGG - Intergenic
957567104 3:81897996-81898018 TTTTTAATTGAAATGGACAAAGG - Intergenic
958728479 3:97935020-97935042 TCTTTAAGAGAATTGGAACATGG + Intronic
958901127 3:99887682-99887704 TATTTATATGAAATGGAACTGGG + Intronic
959016681 3:101142667-101142689 TTTGTAACTGAAAGGGGACAGGG - Intergenic
960045210 3:113190550-113190572 TTTTTAACCAAGATGGAAAAGGG - Intergenic
960150431 3:114243784-114243806 TATTGAATTAAAATGGAACATGG - Intergenic
960464377 3:117978438-117978460 TTTATAACTGCAATAGAAAATGG - Intergenic
960826874 3:121796362-121796384 TTTTTAATTTAAAAGGAAAAGGG - Intronic
960909654 3:122636625-122636647 TTTTTACCTGAAATGTAAACAGG - Intronic
963239615 3:142990413-142990435 TATTAACCAGAAATGGAACAAGG + Intronic
963455831 3:145546059-145546081 TTTAGATTTGAAATGGAACAAGG - Intergenic
963520051 3:146352833-146352855 TTTGGAACTCTAATGGAACAAGG + Intergenic
964502979 3:157368896-157368918 TATTTAACTGAAATTCAACTGGG + Intronic
965235038 3:166107464-166107486 TTTTTACGTGAAAGGGAAGAGGG + Intergenic
965438553 3:168684319-168684341 TTTTTAAATGAATTGTCACAAGG + Intergenic
965905854 3:173705160-173705182 TTTTTAACTGAAATACTAGAAGG + Intronic
967253845 3:187569941-187569963 TTTTAACCTGAAAAGGAATAAGG + Intergenic
968995991 4:3946225-3946247 TTTGTCACTGAGATGGGACAAGG + Intergenic
971138308 4:23894973-23894995 TTTTTAAGTGGAACTGAACAAGG + Intronic
971155843 4:24082141-24082163 CTTTGAACTGAAATGGAAACAGG - Intergenic
971520410 4:27542539-27542561 TTGGAAACTGAAATGGAAAAAGG + Intergenic
971669476 4:29538031-29538053 TTTTTATCTGAGATTGAAAAAGG - Intergenic
971709814 4:30096423-30096445 TTTTTAGTGGAACTGGAACAAGG + Intergenic
971741754 4:30530249-30530271 CTTTTAACTTAAAGGGAAAAAGG + Intergenic
971830726 4:31689915-31689937 TTTTTTACCAAAATGGGACAAGG - Intergenic
972063205 4:34907038-34907060 TTTTTAACAAAAAGGGAAAAGGG - Intergenic
972528292 4:39937756-39937778 TTTTTAATTGAAATGTAAATTGG + Intronic
972601582 4:40577578-40577600 TTTTTAAAAAAATTGGAACAGGG - Intronic
972661511 4:41121279-41121301 TTTTTATCAGGAATGGAAAATGG + Intronic
972670686 4:41211795-41211817 TTTTAAAATGAAATTGAAAAAGG + Intronic
973011246 4:45077181-45077203 TATTTAACTGAAAAGAAATATGG + Intergenic
973719066 4:53705196-53705218 ATTTTAAATGTAATGGAATATGG + Intronic
975271889 4:72445227-72445249 TTTGTAGCTGAAATGACACAGGG + Intronic
976163951 4:82233584-82233606 TGATTAACTAAAAAGGAACAAGG + Intergenic
976881908 4:89936303-89936325 TTTTTAACTGAAATATAATAAGG - Exonic
976948049 4:90794658-90794680 TTTAAAATTCAAATGGAACAAGG - Intronic
977083541 4:92564524-92564546 TTTTTAAATGAAATTGAAGAAGG + Intronic
977522729 4:98105521-98105543 GTTTTAACAGAAATGGGACTGGG + Intronic
978662228 4:111140626-111140648 TTTTTATATGACATAGAACAGGG + Intergenic
978662231 4:111140672-111140694 TTTTTATATGATATAGAACAGGG + Intergenic
979314317 4:119243200-119243222 TTTTAAAATGAAATGGGACCAGG + Intronic
980000964 4:127487605-127487627 TTTTTAAATGGTAGGGAACATGG + Intergenic
981536784 4:145808425-145808447 TTTTTAACTTCAATGGAATTAGG - Intronic
982123871 4:152167777-152167799 TTTTAAAGTGAAATGAAAGATGG + Intergenic
982522229 4:156432583-156432605 TGTTTAACAGTAATGGAAAAGGG + Intergenic
982616608 4:157645037-157645059 TTTTAAACTGAAATGTGGCAGGG - Intergenic
984279719 4:177655231-177655253 TTATTAAATAAAATGGACCAAGG + Intergenic
985121577 4:186648494-186648516 ATTTTTAATGAAATGGATCACGG + Intronic
986219445 5:5754420-5754442 TCTTTACCTGAAGTAGAACAAGG + Intergenic
986567857 5:9133148-9133170 TTTTTAACTGAAATGGAACAAGG - Intronic
987836196 5:23166502-23166524 TTTTTTTCTGAAATGCAAGAGGG + Intergenic
987844589 5:23266075-23266097 TTTTTATCTCACATGGAACATGG + Intergenic
987963604 5:24843143-24843165 TTTTTAGCTGAGATCAAACAAGG - Intergenic
988067838 5:26245060-26245082 TTTTTAAATAAAATGAAACGGGG - Intergenic
990213375 5:53504480-53504502 TTTTTAAATGATATGAAATATGG - Intergenic
990632633 5:57687378-57687400 TATTGAACTGAAAAGGAAAAGGG - Intergenic
990744801 5:58949013-58949035 TTTTTATAGGAATTGGAACATGG - Intergenic
990744869 5:58949719-58949741 TTTTTATAGGAATTGGAACATGG - Intergenic
991635534 5:68700674-68700696 TTTTTAACAAAAATAGAAAAGGG - Intergenic
991934359 5:71787232-71787254 TCTTTGACTAAAATGGAAAATGG + Intergenic
992659696 5:78946043-78946065 TTTTTATCTGCAATGAAAGACGG + Intronic
994113541 5:96036060-96036082 TTTTTAACTGAAAATAAACTTGG - Intergenic
994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG + Intergenic
994630871 5:102285791-102285813 TTTGTAACTGAAATGAATAAAGG - Intronic
995672604 5:114624097-114624119 TTTCTCACTAAAATGGAAAATGG + Intergenic
996039089 5:118790619-118790641 TTTTTAAAGGAAATGAAAGAGGG + Intergenic
996307258 5:122061742-122061764 TTTTTTTCTAAAATAGAACATGG + Intronic
996568973 5:124911877-124911899 TTTCTAACCGAAATAGAATATGG + Intergenic
997093670 5:130886234-130886256 TTTATAACTGAAATTGACTATGG - Intergenic
997440402 5:133905171-133905193 TTTTTAACTGGAATGGAACAGGG + Intergenic
999282325 5:150373937-150373959 TGGCTAAGTGAAATGGAACAGGG + Intronic
999333706 5:150696682-150696704 TTTCTAACTCTGATGGAACACGG - Exonic
999828362 5:155295837-155295859 TTTTTCCCTGAAAGGAAACAGGG - Intergenic
1000078582 5:157820583-157820605 TTTTTAAATGACCTGGAATAAGG - Intronic
1000283140 5:159799819-159799841 TTTTCCACTGAAAGGGAATAGGG + Intergenic
1000448252 5:161351518-161351540 TTTGTATCTGGCATGGAACAAGG - Intronic
1000706261 5:164516211-164516233 TTTTTAACTGAAATGCACAAAGG + Intergenic
1000774192 5:165396604-165396626 TTTTAATCTGTAATGGAACATGG + Intergenic
1000877439 5:166658335-166658357 TGTTTAACTGAACTAGTACATGG + Intergenic
1001840542 5:174872708-174872730 ATTTTTACTGAAATGGGAAAAGG - Intergenic
1002335416 5:178474583-178474605 TTTCTAACTGTAGAGGAACATGG + Intronic
1002786681 6:406009-406031 TTGAGAACTGAAATGAAACATGG + Intronic
1004524852 6:16397598-16397620 TTCTTAAGTGAAATAGAACTAGG + Intronic
1004610767 6:17237377-17237399 TATTTAAATGATATGAAACAAGG + Intergenic
1004953136 6:20697044-20697066 ATTTTGAATGAAATAGAACAAGG - Intronic
1004954565 6:20714668-20714690 TTTTTCACTGAAATGAAAATTGG + Intronic
1004967768 6:20874257-20874279 TTTCTAGATGAAAAGGAACAAGG + Intronic
1005143234 6:22658249-22658271 TTGTTTACTGAAATAGAACCAGG + Intergenic
1005252984 6:23968748-23968770 CTTTGAAGTGAAATGGATCAGGG - Intergenic
1005771330 6:29075727-29075749 TTTATAACTGAAAATGAAAAAGG + Intronic
1006054790 6:31376090-31376112 TTCTTATCTGAAATGGGATATGG - Intergenic
1006659880 6:35632012-35632034 ATTTTCACTAAAATGGAAGAGGG - Intronic
1007136094 6:39523361-39523383 TTTTTAACAGAAAAGTAGCATGG - Intronic
1008344268 6:50407137-50407159 TCTTTAACTGTGAGGGAACAAGG - Intergenic
1008853561 6:56053964-56053986 TTTTCAACTGAAATTGAGCTGGG - Intergenic
1009555261 6:65155946-65155968 TTTTTAACAGAAGAGTAACAAGG + Intronic
1010364142 6:75030384-75030406 TTTTTAACACTAATGTAACAGGG + Intergenic
1010881753 6:81183852-81183874 TGTCTAAATGAAATGGAAGAGGG - Intergenic
1011075405 6:83432209-83432231 TATTTAACTGAAAAGGAAACTGG - Intergenic
1011437264 6:87351585-87351607 TTTTGAACTGAAATGGGGAATGG - Intronic
1011878844 6:91997599-91997621 TTTTATTCTGAAATGAAACAAGG + Intergenic
1013008142 6:106094253-106094275 TTCTTTACTAAAATGGACCAAGG - Intronic
1013166364 6:107596401-107596423 TTTTTACCTGAACTAGAACCAGG - Intronic
1013574796 6:111471468-111471490 GTTTGAATTGAAATGAAACATGG - Intronic
1013640938 6:112080231-112080253 TTATTAGATGAAATGGTACATGG + Intronic
1014504596 6:122239774-122239796 ATTTTCACTGAAATTGAAAAAGG - Intergenic
1015061365 6:128970499-128970521 TTTATAACTGAAATTGGATATGG + Intronic
1017148434 6:151255880-151255902 CTTTTAACTGAACTTGAACTTGG + Intronic
1018436082 6:163760247-163760269 TTTTCCACAGAAATGAAACATGG - Intergenic
1018990605 6:168670839-168670861 GGTTAAACTAAAATGGAACAGGG + Intronic
1020959417 7:14783921-14783943 TATTTAACAGAAATTTAACAAGG - Intronic
1021089169 7:16462016-16462038 TTTTGAAGTGAAATGTCACAGGG + Exonic
1021182644 7:17525826-17525848 GTTTTAACGGAAATTCAACAGGG + Intergenic
1021402681 7:20227465-20227487 TTTTTTTCTGAAATGGAAAATGG - Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022649820 7:32264459-32264481 TTTTTAAGTCAGATGGAACTAGG - Intronic
1022971961 7:35526565-35526587 TTTTCAACTGCAATGAAACTGGG - Intergenic
1023173778 7:37415952-37415974 TTTTTAACTTAATTTGTACATGG - Intronic
1023330235 7:39107748-39107770 TCTTTACCTGAAAGGGACCAGGG + Intronic
1024388990 7:48785741-48785763 TTTTTATCTCAAATGTAAAAAGG - Intergenic
1024977890 7:55130717-55130739 TTTCTAAATGAAAAAGAACAGGG + Intronic
1027008968 7:74725299-74725321 GTTTTAAGTCATATGGAACATGG - Intronic
1028086072 7:86639456-86639478 TTTTCTACTGAAATGAAAGAAGG - Intergenic
1029654694 7:101916545-101916567 TTGCTAACTGACATGGGACAGGG - Intronic
1029670519 7:102027411-102027433 TTTCTATCTGAAATGGACCTGGG - Intronic
1030171587 7:106608153-106608175 GTTTTAAATGAAAAGGAACTGGG + Intergenic
1030464475 7:109882587-109882609 TTTTTCACTGAAAGTGAACCAGG - Intergenic
1031321244 7:120331315-120331337 TTTGTAACAGAAAAGGATCAAGG + Intronic
1032458117 7:132088664-132088686 TTTTTATCTGTAAAGGGACAAGG + Intergenic
1032983762 7:137314922-137314944 TATGTAACTGAAATAAAACATGG - Intronic
1032998585 7:137477570-137477592 TTTTTAACAGTAATGTACCATGG - Intronic
1033517452 7:142122051-142122073 TTTTTAAAAGAAATGGAAAATGG + Intronic
1033773090 7:144575695-144575717 TTCATAACTGAAATGGAACTAGG - Intronic
1034912806 7:155011412-155011434 TTTGTGACTGAGAGGGAACATGG - Intergenic
1035402971 7:158579734-158579756 TTTTTCACTGAAATAGAAAGAGG - Intronic
1035536855 8:398421-398443 TTTTTAGCTGAAATGAAAAGTGG + Intergenic
1035752324 8:2004916-2004938 TTTTTATATGAAATGGGACCAGG + Exonic
1036190729 8:6668331-6668353 TTTTTAATAACAATGGAACATGG + Intergenic
1036667450 8:10756800-10756822 ATGTTAACTGAACTGGAAGAGGG - Intronic
1038923026 8:32106748-32106770 TTTTTAAAAAAAATGGAACTGGG + Intronic
1039741295 8:40385304-40385326 TATGTAACAGAAAAGGAACATGG + Intergenic
1040519349 8:48161653-48161675 TTTTTAAATTAAATAAAACATGG - Intergenic
1040585564 8:48737256-48737278 TTTTTAACTTTAAGGGAACATGG - Intergenic
1041627977 8:60053024-60053046 TTTTTAACGTAAATTGAACTAGG - Intergenic
1042691778 8:71507917-71507939 TTTTTAACTTAAAAGGCATAGGG - Intronic
1042953882 8:74227871-74227893 TTCTTAGCTGAAATGGGAAAAGG - Intergenic
1045303260 8:100933668-100933690 TTTTTAACTGAAGAGAAAAAAGG + Intronic
1045477739 8:102567741-102567763 ATTTTAATTGAAATGGATCAAGG + Intergenic
1046106903 8:109677244-109677266 TTTTTAATTGAAAAGGTACCAGG - Intronic
1046116137 8:109786081-109786103 TTTTAAAATGAAAAGGAACATGG - Intergenic
1046144776 8:110144329-110144351 TCTATAAATGAAATGGAATACGG + Intergenic
1046629280 8:116607517-116607539 TCTTTTACTGAGATGGAAGAGGG - Intergenic
1048840935 8:138565576-138565598 TTTTTATTTGAAATGGAAATAGG + Intergenic
1050172651 9:2838693-2838715 TTTAAAACTGAAAATGAACAAGG + Intronic
1050265604 9:3886389-3886411 TTTTAAACTGAAATGCATTATGG - Intronic
1050768562 9:9167278-9167300 TTTTTAAATGCAATGCAAGATGG + Intronic
1050925149 9:11255561-11255583 TTTTTATCTGACCTGGGACAGGG + Intergenic
1051403255 9:16706474-16706496 TTTGTTACTGAAAGGGGACATGG - Intronic
1051858322 9:21595516-21595538 GCTTTAACTGAAAGGGAACCAGG - Intergenic
1052045432 9:23788625-23788647 CTTTTTACTTAAAGGGAACATGG + Intronic
1053244777 9:36525781-36525803 TTTTGAATTGAAAAGGAAAAGGG + Intergenic
1053504130 9:38626782-38626804 TTTTTAATATAAATGGAAGATGG + Intergenic
1055135398 9:72823877-72823899 TTTTTACATGAAAAGAAACATGG + Intronic
1055463400 9:76540410-76540432 ATTTTAAATGGAATGGAACAGGG - Intergenic
1056005077 9:82260923-82260945 ATTTTAACTGATCTGGAAAAAGG - Intergenic
1057143597 9:92743493-92743515 TTTTTAAATAAAATGGAAAGAGG - Intronic
1057152246 9:92806812-92806834 TTTTTAATATAAATGGAAGATGG - Intergenic
1057390362 9:94637761-94637783 CTTTTAACTGAAGTGTAACTGGG - Intronic
1058505519 9:105662234-105662256 TTTTTAACTTAAAAACAACAGGG - Intergenic
1059286068 9:113172658-113172680 TTTTTACCTGATTGGGAACAAGG - Intronic
1062157093 9:135057056-135057078 TTTTTATCTGAAATGAATAAAGG + Intergenic
1185694098 X:2181936-2181958 TTTTCACCTGAAATGGAGCCAGG - Intergenic
1185716080 X:2343401-2343423 CTTTTGAATGAAATGTAACATGG - Intronic
1186858469 X:13648193-13648215 TTACAAAATGAAATGGAACAAGG - Intergenic
1186883505 X:13889837-13889859 TTTTTAACTGAAAAGGACTTTGG + Intronic
1187668855 X:21648163-21648185 ATTTTAATTAAAATGAAACATGG - Intronic
1188438513 X:30190188-30190210 TTTTTAATTGAAAGGGACAAAGG - Intergenic
1188877633 X:35450413-35450435 TTGTTGACTGAAATGAAAAATGG - Intergenic
1189459572 X:41228290-41228312 TTTTTAACACAAAAGAAACAAGG + Intronic
1190419002 X:50209081-50209103 TTTTTAAAAGAAATAAAACAAGG - Intronic
1190419421 X:50213849-50213871 TTTTTAAAAGAAATAAAACAGGG - Intronic
1192625360 X:72721581-72721603 TTTGATACTGAAATGAAACAAGG - Intergenic
1194250310 X:91566705-91566727 TTTTGGGCTGAAATGGAGCAAGG - Intergenic
1194759613 X:97779555-97779577 TGTTTTAATGAAATGGAAAATGG + Intergenic
1202365975 Y:24165113-24165135 TTTTCAACTGAAATGGTTAATGG - Intergenic
1202374445 Y:24220905-24220927 TTTTCAACTGAAATGGGCAATGG + Intergenic
1202496335 Y:25449215-25449237 TTTTCAACTGAAATGGGCAATGG - Intergenic
1202504807 Y:25505010-25505032 TTTTCAACTGAAATGGTTAATGG + Intergenic