ID: 986572463

View in Genome Browser
Species Human (GRCh38)
Location 5:9179805-9179827
Sequence CTGTAAGAGCAGATGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986572462_986572463 -1 Left 986572462 5:9179783-9179805 CCAGGCTACTCTTTAAATTTGAC 0: 1
1: 0
2: 0
3: 29
4: 486
Right 986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG 0: 1
1: 0
2: 1
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986572463 Original CRISPR CTGTAAGAGCAGATGCAGTG TGG Intronic
900927799 1:5717127-5717149 CTGGGAGAGCAGATGCAGGCTGG + Intergenic
902712417 1:18249503-18249525 CTGTACGTGCAAAAGCAGTGTGG + Intronic
903695181 1:25201153-25201175 CTGTCAGAGGAGCTGCAGTGGGG - Intergenic
903943765 1:26949273-26949295 CTGGGAGAGCAGAGGCAGTTCGG + Intergenic
904912453 1:33945513-33945535 CTGGAAGAGTGGATGCAGAGGGG + Intronic
904914971 1:33963229-33963251 GCAGAAGAGCAGATGCAGTGAGG - Intronic
905330512 1:37192238-37192260 CTGTAAGAGGAAATGCAGATGGG - Intergenic
905725860 1:40251529-40251551 CAGTCAGAGCAGCTGCAGTAGGG - Exonic
905881027 1:41463856-41463878 CTGTATGAGGAGCTGAAGTGGGG + Intergenic
907194750 1:52677359-52677381 CTGTCAGGGCTGATGCAGAGGGG - Intergenic
908420735 1:63956078-63956100 CTGTTAGAGCATGTGCAGTCTGG + Intronic
909945786 1:81661877-81661899 CTGTTAGAGGATATCCAGTGGGG - Intronic
913967457 1:143388875-143388897 CTGGAAGTGCAGATTCAGTCTGG + Intergenic
914061832 1:144214469-144214491 CTGGAAGTGCAGATTCAGTCTGG + Intergenic
914117318 1:144751885-144751907 CTGGAAGTGCAGATTCAGTCTGG - Intergenic
914929294 1:151916084-151916106 CAGTAAGAGCAGCTGAGGTGGGG + Intergenic
916038846 1:160945178-160945200 CGTTAAGAGCAGCTGCAGTCGGG - Exonic
916229636 1:162528104-162528126 GTATAAGAGCAAATGTAGTGAGG + Exonic
917213064 1:172649665-172649687 CTGAGAGAGTAGAGGCAGTGTGG + Intergenic
920975324 1:210780495-210780517 GTGGAACAGCAGATGCAGTGGGG + Intronic
922239620 1:223747190-223747212 CAGCAAGAGCAGATGGGGTGAGG - Intronic
922871634 1:228906757-228906779 CTGGAAGAGCAGGGGAAGTGAGG + Intergenic
922897303 1:229110314-229110336 CTATAACTGCAGAAGCAGTGAGG - Intergenic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1063370608 10:5520000-5520022 CTGAAAGATGAGTTGCAGTGTGG - Intergenic
1063470692 10:6282508-6282530 CCGTAGCAGCAGATGTAGTGAGG + Intergenic
1063639117 10:7813558-7813580 CTGAAAGAGCAGATGCAAGATGG + Intergenic
1063873813 10:10450321-10450343 CGGTAAGAGGAGTTGGAGTGAGG - Intergenic
1064509221 10:16071525-16071547 CTGTGAGGGCAGAGGAAGTGAGG - Intergenic
1064587841 10:16856749-16856771 CTGTACGAGCAGATACAGACTGG + Intronic
1067512053 10:46904325-46904347 CTCTCAGTGCATATGCAGTGAGG - Intergenic
1067650193 10:48147499-48147521 CTCTCAGTGCATATGCAGTGAGG + Intergenic
1069341975 10:67421417-67421439 ATGTTAGAGCAGATGCAGTTTGG - Intronic
1071174357 10:82907110-82907132 CGCTAAGAGCAGCTACAGTGAGG + Intronic
1071178886 10:82959940-82959962 CTGAAAGTGCGGATGCTGTGTGG - Intronic
1071713336 10:88071131-88071153 CGGCAAGAGCATATGCAGTCAGG + Intergenic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1076146741 10:128127777-128127799 CTGCAAATGCAGAAGCAGTGAGG + Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1077972956 11:7214899-7214921 ATGTCAGAGCAGATGTAGTCGGG - Intergenic
1080180919 11:29425182-29425204 CAGTAAGAGCAGTTTCAGTGGGG - Intergenic
1080740462 11:35059163-35059185 CAGTGAGAGCAGTTGCAGTGAGG + Intergenic
1081994769 11:47356308-47356330 ATGTGTAAGCAGATGCAGTGTGG - Intronic
1083145946 11:60758839-60758861 CTGGAAGAGCAGCTACAGTGTGG + Intronic
1083484115 11:62972361-62972383 TTGAAAGAGGAGGTGCAGTGGGG + Intronic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1086412236 11:86554219-86554241 CCATAAGAGCATATGGAGTGAGG + Intronic
1089270099 11:117296205-117296227 CTTTAAGATAAGAGGCAGTGAGG - Intronic
1091413648 12:261386-261408 CTGAAAGAGCAGGGGCAGAGTGG - Intronic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092690845 12:11108597-11108619 CTGTAAGGGACCATGCAGTGAGG + Intronic
1095241234 12:39861204-39861226 CTGTAATAGAAGATGAAGTTGGG - Intronic
1096309253 12:50505482-50505504 CAGGAAGCGCAGAAGCAGTGTGG - Intronic
1098359500 12:69641137-69641159 CTAAAAGAGCAGATACAGGGTGG - Intergenic
1098714017 12:73806045-73806067 CTGTTAGAGCTGATGCACTAGGG - Intergenic
1100112469 12:91262070-91262092 TTGTCAGAAGAGATGCAGTGTGG - Intergenic
1100769536 12:97906303-97906325 CTGAAAGAGCAGTTGGCGTGAGG - Intergenic
1106679601 13:31996654-31996676 CTGGAAGAGCAGATGGAAAGTGG + Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1110961927 13:81637582-81637604 CTATAAAAGCAGCTGCAGTTGGG + Intergenic
1112924400 13:104656062-104656084 ATGAAAGAGCTGATTCAGTGTGG - Intergenic
1113246433 13:108401879-108401901 CTGTACTTGCAGATGCAGTCAGG - Intergenic
1113383079 13:109821272-109821294 CAGGAAGAGCAGATGCAGGGAGG - Intergenic
1113425917 13:110208277-110208299 GTGTGGGAGGAGATGCAGTGTGG - Intronic
1116295042 14:43096972-43096994 GTGAATAAGCAGATGCAGTGTGG + Intergenic
1116652293 14:47609004-47609026 CTAGAAGAGCAGGTCCAGTGAGG + Intronic
1117222745 14:53621842-53621864 CTGAAAGCTCAGATGAAGTGAGG - Intergenic
1117442899 14:55776869-55776891 CAGTAAGAGAAGATGCAGGCCGG + Intergenic
1117785337 14:59278181-59278203 CTGTGTGATCAGATGAAGTGAGG + Intronic
1119577169 14:75735352-75735374 CTGTGGGAGCAGAAGCACTGTGG + Intronic
1120869211 14:89322157-89322179 CTGTAAGAGCAGAGCCATTATGG - Intronic
1121788077 14:96677936-96677958 CTGGAAGAGGAGATTTAGTGGGG + Intergenic
1124179028 15:27456086-27456108 CTGCAGGACCAGAAGCAGTGCGG - Intronic
1126097539 15:45100169-45100191 CTGCAAGAGAAGATGCAGCGAGG - Exonic
1126742954 15:51796784-51796806 CTGTATGATGAGATGAAGTGAGG + Intronic
1126778238 15:52117928-52117950 CTGGAAGAGCTGATTGAGTGGGG - Exonic
1127699191 15:61480545-61480567 CTGTGAAAGCAAATGCAGTCGGG + Intergenic
1127733018 15:61817463-61817485 CTGTAAGAGAAGATGCCTGGTGG + Intergenic
1128211093 15:65903036-65903058 CAGGAAGAGAAGAGGCAGTGTGG - Intronic
1129628559 15:77232594-77232616 GTGTGAGAGTAGATGCAGTTAGG - Intronic
1129865426 15:78904065-78904087 CTGTAAGTCCATATTCAGTGTGG + Intergenic
1129879164 15:78995872-78995894 GCGTAAGAGCAGAGGCCGTGTGG - Intronic
1131273034 15:90958226-90958248 CTGTTAGAGCCCATGCAGAGAGG + Intronic
1132062550 15:98704372-98704394 CTGAAGGAGCAGAAGCACTGTGG + Intronic
1132087237 15:98918340-98918362 CTGTAAGAGCAGAGTCACTGTGG - Intronic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1134421638 16:14097125-14097147 TTCTAAGAGGAGATGCAGAGTGG + Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1137591852 16:49698608-49698630 CTGTGCGAGCAGATAAAGTGAGG - Intronic
1139197270 16:64934069-64934091 CTGTCAGAGGAGATGGAATGAGG + Intergenic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1139574280 16:67831446-67831468 CTCTTAGAACAGATGCTGTGAGG + Intronic
1139923065 16:70471562-70471584 CTGGCAGAGCAGATGCAAGGAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143631514 17:8142885-8142907 CAGTAAGAGCAGTTGAAGGGAGG - Intronic
1144923589 17:18784307-18784329 CAGTAAGAGCAGTTCCAGTATGG - Intronic
1146316436 17:31810833-31810855 CTTTATTAGAAGATGCAGTGTGG + Intergenic
1147238987 17:39078103-39078125 CTGTAAGAGAAGATGCTTTCAGG - Intronic
1151984261 17:77531920-77531942 TTGTCAGAGCAGAGACAGTGTGG + Intergenic
1152236819 17:79143261-79143283 CTGTAAGGACAGAGGCAGGGTGG - Intronic
1155266271 18:24097371-24097393 CTGTAATAGGAGATGAAATGTGG - Intronic
1157722510 18:49936320-49936342 CTCCATGAGCAGATGCAGGGAGG + Exonic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1163141855 19:15355099-15355121 CTGGAAGAGCAGGTGCCCTGTGG - Exonic
1163643191 19:18473440-18473462 CTATCAGAGCAGGTGCGGTGGGG + Intronic
1164598498 19:29545997-29546019 AGGTGAGAGCTGATGCAGTGAGG + Intronic
1165672340 19:37689910-37689932 CTGTAATAGCTGCTGCAATGGGG - Exonic
1166898604 19:46040497-46040519 AGGTGAGAACAGATGCAGTGAGG - Exonic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1202701243 1_KI270712v1_random:166343-166365 CTGGAAGTGCAGATTCAGTCTGG + Intergenic
925030599 2:647786-647808 CTGGAAGGGCCGGTGCAGTGAGG - Intergenic
925878540 2:8331854-8331876 CTGTAAGAGCACTTCCACTGGGG + Intergenic
925926335 2:8673483-8673505 GTGTCAGAGAAGGTGCAGTGGGG + Intergenic
926292556 2:11542336-11542358 CTCCAAGAGCAGATGCAGCCGGG - Intronic
927277408 2:21273616-21273638 CTGTCAGAGCAGACGCAGCCAGG - Intergenic
930243450 2:48959426-48959448 CTGCAAGAGCAAATGGAGGGAGG - Intergenic
931237900 2:60427178-60427200 TTGTAGGAGGAGATTCAGTGGGG + Intergenic
932581038 2:72992900-72992922 CTGTATGAGGAGGTGCCGTGAGG + Intronic
932624449 2:73286062-73286084 CTGCAAGAGCAGATGGATTTGGG - Intergenic
932922261 2:75929781-75929803 CTGTAGAAGCGGGTGCAGTGGGG + Intergenic
932988381 2:76756004-76756026 CTGAAAGAGCAGATGCTTTGTGG + Intronic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
934172160 2:89549780-89549802 CTGGAAGTGCAGATTCAGTCTGG + Intergenic
934282472 2:91624132-91624154 CTGGAAGTGCAGATTCAGTCTGG + Intergenic
935091802 2:99901736-99901758 GAGAAAGAGCAGATGCAGGGAGG - Intronic
935933517 2:108155698-108155720 CTATGAGACAAGATGCAGTGTGG + Intergenic
936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG + Intronic
936157654 2:110058970-110058992 TTGTAAGAGCAGAGAGAGTGTGG - Intergenic
936187038 2:110312474-110312496 TTGTAAGAGCAGAGAGAGTGTGG + Intergenic
938199592 2:129362082-129362104 CTGGAGGAGCAGAGGCTGTGGGG - Intergenic
939557795 2:143697647-143697669 CTTTAAGAGGAGATGCTCTGGGG - Intronic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
939849643 2:147289236-147289258 TCGTAAGAGCAGTTTCAGTGTGG + Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
942834668 2:180279343-180279365 ATGTAAGAGCAGATACAGAGAGG - Intergenic
948077737 2:235179444-235179466 GTGTGAGAGAAGACGCAGTGTGG + Intergenic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
1169224550 20:3847794-3847816 GTGTATGACCAGTTGCAGTGAGG + Intronic
1171128847 20:22629464-22629486 CTGTAAGAACAAAGACAGTGAGG - Intergenic
1173571391 20:44078961-44078983 CTGGAAGGGGAGATGCAGTCTGG - Intergenic
1175370143 20:58482861-58482883 CTGTAAGTGCAGATGGAAGGAGG - Intronic
1175764205 20:61581706-61581728 CTGGCAGAGCTGATGCAGTCGGG - Intronic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176312535 21:5160415-5160437 CCATAACAGGAGATGCAGTGTGG - Intergenic
1179409367 21:41150257-41150279 GTGTGAGAGCAGATGCAATGCGG + Intergenic
1179844513 21:44101615-44101637 CCATAACAGGAGATGCAGTGTGG + Intronic
1180997409 22:19972337-19972359 AGGTGAGTGCAGATGCAGTGTGG - Exonic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
950319836 3:12041073-12041095 CCCTCAGAGCAGATGGAGTGAGG + Intronic
950870276 3:16222401-16222423 ATGTAAGAGCAGGTGGAATGTGG + Intronic
952732093 3:36649373-36649395 CTGTAATAACAGATGGAATGAGG - Intergenic
957494853 3:80979372-80979394 ATGAAAGAGAAGATGCAATGAGG - Intergenic
957496635 3:81000066-81000088 CTGTATGAGCAGATTGAATGAGG - Intergenic
960044959 3:113187625-113187647 CTGTCACAGCAGCTACAGTGGGG - Intergenic
960821584 3:121738656-121738678 CTGAAAGAGCTGAGGCAGTCTGG + Intronic
961752182 3:129103207-129103229 CAGCTAGGGCAGATGCAGTGGGG - Intronic
962605009 3:137025696-137025718 CCATAAGAGCTGATGTAGTGGGG + Intergenic
964389374 3:156181792-156181814 CTGAAAGAGGAAAGGCAGTGAGG + Intronic
965307499 3:167084782-167084804 CTGTTAGAGATTATGCAGTGAGG - Intergenic
965324494 3:167286259-167286281 GTGTAGGAGAAGATGCAGTTAGG + Intronic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
966949343 3:184802241-184802263 CTGAAAGTGCAGGTGCAGTGTGG + Intergenic
967903172 3:194477790-194477812 CTGTAGGAGTGGATGAAGTGAGG - Intronic
968282190 3:197485367-197485389 CTGGAACAGCAGATGCCTTGGGG + Intergenic
968967956 4:3778865-3778887 CTGTAACAGCACCTGCTGTGTGG + Intergenic
969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG + Intergenic
970455526 4:16219996-16220018 CTGGCAGAGCAGAAGCAGCGAGG - Intronic
970940295 4:21624822-21624844 CTGTAAGAGCATAATAAGTGGGG - Intronic
972202582 4:36733158-36733180 ATTTAAAATCAGATGCAGTGTGG - Intergenic
972607424 4:40626693-40626715 CTGTATGGGGAGAGGCAGTGGGG - Intronic
972724345 4:41733108-41733130 GTGTATGACCAGATGCAGTAGGG + Intergenic
976613789 4:87055574-87055596 CTGGGAGAGCACATGCAGTCTGG - Intronic
976854714 4:89590160-89590182 CTGCAAAAGCAGAGGCACTGGGG - Intergenic
979166000 4:117532163-117532185 CTGTAAGAGAATATAAAGTGAGG - Intergenic
983375372 4:166921134-166921156 CTGTCAGAGCTAATGCAGAGTGG - Intronic
984003060 4:174274147-174274169 CTGAAAGAGCAGCTGCAGCTGGG - Intronic
984253419 4:177361914-177361936 CTGTAAGATCAGGTGAGGTGCGG - Intronic
984651148 4:182271887-182271909 CTGTGAGAGCAGGTGCAGCAGGG + Intronic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986792167 5:11172708-11172730 CGTTAAGAGAAGATGCAGCGTGG + Intronic
988402778 5:30783331-30783353 CTAAAAGAGAAGATGCGGTGTGG + Intergenic
988520283 5:31939449-31939471 CTGTGTGGCCAGATGCAGTGAGG + Intronic
988852299 5:35191881-35191903 CTGCAAGAGCAAAGGCACTGAGG - Intronic
989716357 5:44468039-44468061 TTGTAACAGCAGTGGCAGTGTGG + Intergenic
991392056 5:66155557-66155579 CTGTAAGAGGAGATGTGCTGTGG + Intronic
993469450 5:88288870-88288892 CTGTCAGAGCAGAGACTGTGGGG - Intergenic
993548566 5:89244454-89244476 CTGTAGGAGCACATGGAGTTTGG + Intergenic
999875507 5:155801291-155801313 GTGGAAGACCAGATGCAGAGGGG - Intergenic
1000583069 5:163057367-163057389 ATGCAAGAGCAGAAGCAATGGGG - Intergenic
1002170048 5:177369868-177369890 CTGCAGGAGCAGGTGGAGTGTGG - Intronic
1002713840 5:181212763-181212785 CTGTAAGAGCAGATGAAATTCGG - Intergenic
1003439923 6:6130902-6130924 CAATAAAAGCAGATGCAGTCTGG - Intergenic
1004140870 6:13015639-13015661 CTGTAAATGCTGCTGCAGTGAGG + Intronic
1007130859 6:39472175-39472197 TTGGAAGAGCAGTTTCAGTGAGG - Intronic
1007151772 6:39700610-39700632 TTGTAATAGTAGATACAGTGAGG - Intronic
1009461959 6:63924113-63924135 ATGTAAAATCATATGCAGTGAGG - Intronic
1010610206 6:77945458-77945480 CTTAAAAAGCAGTTGCAGTGTGG + Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1015281569 6:131440442-131440464 CTGTCAAAGTAGATGCAGTGGGG - Intergenic
1016492382 6:144620952-144620974 TAGTAAGAGCAGCTCCAGTGTGG + Intronic
1016620302 6:146101586-146101608 CTGGCAGAGCAGTTGCAGTGTGG - Intronic
1017336134 6:153262486-153262508 CTGTAAGTGCACATGGAGAGTGG - Intergenic
1017515988 6:155156198-155156220 CAGTGGGAGCAAATGCAGTGTGG + Intronic
1018646451 6:165953136-165953158 CTGCAAGAACAGAGGCACTGAGG - Intronic
1018885145 6:167928843-167928865 GTGTAAGAGCAAATGCAAAGAGG - Intronic
1021603102 7:22384052-22384074 CTGTAGAAGCAAAAGCAGTGAGG + Intergenic
1022647110 7:32241879-32241901 ATGTGAGTGCAGATGCAGGGAGG + Intronic
1023935708 7:44738310-44738332 CTGTATAAACACATGCAGTGGGG + Intergenic
1025851314 7:65246956-65246978 CTGTAAAAGTAGATGAAGAGGGG + Intergenic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1030619695 7:111775483-111775505 AAGTAAGAGCAGATGGACTGAGG + Intronic
1030764204 7:113389030-113389052 CTGTAAGTGCAAAGGCTGTGAGG + Intergenic
1031898046 7:127376307-127376329 CTGAAAGCGTAGATGCATTGTGG - Intronic
1032437541 7:131912495-131912517 AGGTAGGAACAGATGCAGTGGGG - Intergenic
1034809328 7:154117547-154117569 CTGCAAGAGAAGATAGAGTGGGG - Intronic
1035627685 8:1084567-1084589 CTGAAAGCACAGAAGCAGTGAGG - Intergenic
1038179669 8:25214627-25214649 CTTTAAGAGAAGTGGCAGTGGGG - Intronic
1038351402 8:26779479-26779501 CTGTAAGAGCAGATGCTTCTAGG + Intronic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1038676490 8:29627575-29627597 ATGTAAGAGCAGATGGGATGAGG - Intergenic
1041193056 8:55372905-55372927 CTGTCAGAGCAGATGCAAGGGGG + Intronic
1045910248 8:107399177-107399199 CTGGAATAGGAGATGAAGTGAGG - Intronic
1046918707 8:119704347-119704369 TTTGAAGAGTAGATGCAGTGTGG - Intergenic
1048332802 8:133482547-133482569 AAGTGAAAGCAGATGCAGTGGGG - Intronic
1049312468 8:141940483-141940505 CTGTCAGAGCAGCTGGAGAGGGG - Intergenic
1050880896 9:10699535-10699557 CTGTCAGATCAGCAGCAGTGGGG + Intergenic
1051173769 9:14344706-14344728 CTGTAGGAGGAGGTTCAGTGGGG - Intronic
1051859510 9:21608494-21608516 CTGTAAGACCAAATGTAGTGAGG + Intergenic
1054458551 9:65449783-65449805 CTGTAAGAGGAGGTGCGATGGGG - Intergenic
1054811994 9:69442331-69442353 CTATAAGAGCTGAGGCAGCGGGG + Intronic
1055030802 9:71769657-71769679 CTGTGAGAGCAGCTCCAGCGAGG - Intronic
1055936277 9:81607444-81607466 GTGTAATAGAAGATGCAGTGGGG - Intronic
1057529261 9:95829998-95830020 GTGTGAAAGCTGATGCAGTGTGG + Intergenic
1057569516 9:96193845-96193867 GTGTCAGAGCAGGTGGAGTGGGG + Intergenic
1059615867 9:115950175-115950197 GAGTAAGGGGAGATGCAGTGGGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1062568292 9:137172925-137172947 CTGGAATAGCAGGTGCAGGGAGG - Intergenic
1185765151 X:2719399-2719421 CTCTCAGAGGAGAGGCAGTGGGG - Intronic
1191921095 X:66257843-66257865 CTGTAAGAACATAAGAAGTGGGG + Intronic
1194487634 X:94505297-94505319 CTCTAAGAGCAGAGGCAGTGAGG + Intergenic
1198375045 X:136030526-136030548 CAGGAAGAGCAGCTGGAGTGGGG - Intronic