ID: 986573031

View in Genome Browser
Species Human (GRCh38)
Location 5:9184768-9184790
Sequence TTACTTTGCTTGGAAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 2, 2: 2, 3: 56, 4: 611}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986573031_986573035 7 Left 986573031 5:9184768-9184790 CCTTTTTTTTCCAAGCAAAGTAA 0: 1
1: 2
2: 2
3: 56
4: 611
Right 986573035 5:9184798-9184820 GCACATGTCCTGCTCCTGCTGGG No data
986573031_986573034 6 Left 986573031 5:9184768-9184790 CCTTTTTTTTCCAAGCAAAGTAA 0: 1
1: 2
2: 2
3: 56
4: 611
Right 986573034 5:9184797-9184819 GGCACATGTCCTGCTCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986573031 Original CRISPR TTACTTTGCTTGGAAAAAAA AGG (reversed) Intronic
902459759 1:16565181-16565203 TTAAATTGATTGGAAAAATATGG - Intronic
905905100 1:41612683-41612705 ATCCTTTGCTTGGACAAATACGG + Intronic
906768954 1:48465766-48465788 TTACTTTTTTTGGAAAATCATGG - Intronic
907086059 1:51675327-51675349 TGGCTTCTCTTGGAAAAAAAAGG - Intronic
908317880 1:62951855-62951877 TTTCATTGCTTTGAAAAAAAAGG - Intergenic
909127223 1:71688263-71688285 TTACATTGCCCGGAAAACAAAGG + Intronic
909292363 1:73899849-73899871 TGACTTTGCATAGAAAAAGATGG - Intergenic
909436574 1:75648755-75648777 GAACTTTGATGGGAAAAAAAAGG + Intergenic
909966674 1:81920783-81920805 TTTCTTTGGTTGGATAACAAGGG - Intronic
910053400 1:83003510-83003532 TTACTTTGCTTGTCAAAGGAGGG - Intergenic
910246587 1:85144910-85144932 TTACTTTATGTGGAAAATAAAGG + Intergenic
910280494 1:85495304-85495326 TGACTTTGCTTGGAATAACAGGG - Intronic
910462255 1:87460158-87460180 TTGCTTTCTTTGGACAAAAAGGG + Intergenic
911367356 1:96954537-96954559 TGACCTTATTTGGAAAAAAAAGG - Intergenic
911934190 1:103946056-103946078 ATACTTTGCTTGGATATAACTGG + Intergenic
912781928 1:112558808-112558830 TTACTGTGTTTTAAAAAAAATGG - Intronic
913172590 1:116246084-116246106 TTACCTTATCTGGAAAAAAAGGG + Intergenic
913194417 1:116443707-116443729 CTTCCTTGCTTGGAAGAAAATGG - Intergenic
913350906 1:117857948-117857970 TTATCGTGCTTGGAAAAAATAGG + Intergenic
913605834 1:120464978-120465000 TTAAGTTGATTGGAAAAATATGG + Intergenic
913989532 1:143597904-143597926 TTAAATTGATTGGAAAAATACGG - Intergenic
914082719 1:144424238-144424260 TTAAATTGATTGGAAAAATATGG - Intronic
914177626 1:145292752-145292774 TTAAGTTGATTGGAAAAATATGG - Intronic
914178171 1:145297510-145297532 TTAAGTTGATTGGAAAAATATGG - Intronic
914178716 1:145302272-145302294 TTAAGTTGATTGGAAAAATATGG - Intronic
914179094 1:145305441-145305463 TTAAGTTGATTGGAAAAATATGG - Intronic
914179470 1:145308624-145308646 TTAAGTTGATTGGAAAAATATGG - Intronic
914180014 1:145313380-145313402 TTAAGTTGATTGGAAAAATATGG - Intronic
914180559 1:145318152-145318174 TTAAGTTGATTGGAAAAATATGG - Intronic
914181102 1:145322914-145322936 TTAAGTTGATTGGAAAAATATGG - Intronic
914181645 1:145327662-145327684 TTAAGTTGATTGGAAAAATATGG - Intronic
914182190 1:145332429-145332451 TTAAGTTGATTGGAAAAATATGG - Intronic
914182735 1:145337185-145337207 TTAAGTTGATTGGAAAAATATGG - Intronic
914183280 1:145341935-145341957 TTAAGTTGATTGGAAAAATATGG - Intronic
914183824 1:145346693-145346715 TTAAGTTGATTGGAAAAATATGG - Intronic
914184368 1:145351465-145351487 TTAAGTTGATTGGAAAAATATGG - Intronic
914184912 1:145356227-145356249 TTAAGTTGATTGGAAAAATATGG - Intronic
914185457 1:145360974-145360996 TTAAGTTGATTGGAAAAATATGG - Intronic
914186003 1:145365728-145365750 TTAAGTTGATTGGAAAAATATGG - Intronic
914186549 1:145370488-145370510 TTAAGTTGATTGGAAAAATATGG - Intronic
914187093 1:145375236-145375258 TTAAGTTGATTGGAAAAATATGG - Intronic
914187636 1:145379988-145380010 TTAAGTTGATTGGAAAAATATGG - Intronic
914188181 1:145384742-145384764 TTAAGTTGATTGGAAAAATATGG - Intronic
914188724 1:145389492-145389514 TTAAGTTGATTGGAAAAATATGG - Intronic
914269523 1:146067551-146067573 TTACGTTGATTGGAAAAATATGG - Intronic
914269878 1:146070695-146070717 TTAAGTTGATTGGAAAAATATGG - Intronic
914270418 1:146075417-146075439 TTAAGTTGATTGGAAAAATATGG - Intronic
914270955 1:146080153-146080175 TTAAGTTGATTGGAAAAATATGG - Intronic
914271493 1:146084889-146084911 TTAAGTTGATTGGAAAAATATGG - Intronic
914272028 1:146089610-146089632 TTAAGTTGATTGGAAAAATATGG - Intronic
914272564 1:146094328-146094350 TTAAGTTGATTGGAAAAATATGG - Intronic
914273102 1:146099050-146099072 TTAAGTTGATTGGAAAAATATGG - Intronic
914273641 1:146103772-146103794 TTAAGTTGATTGGAAAAATATGG - Intronic
914274179 1:146108490-146108512 TTAAGTTGATTGGAAAAATATGG - Intronic
914274715 1:146113200-146113222 TTAAGTTGATTGGAAAAATATGG - Intronic
914275248 1:146117918-146117940 TTAAGTTGATTGGAAAAATATGG - Intronic
914275785 1:146122654-146122676 TTAAGTTGATTGGAAAAATATGG - Intronic
914367040 1:146988556-146988578 TTAAATTGATTGGAAAAATAAGG + Intronic
914367576 1:146993314-146993336 TTAAATTGATTGGAAAAATAAGG + Intronic
914485407 1:148104908-148104930 TTAAATTGATTGGAAAAATAAGG - Intronic
914532356 1:148534232-148534254 TTACGTTGATTGGAAAAATATGG - Intronic
914532716 1:148537382-148537404 TTAAGTTGATTGGAAAAATATGG - Intronic
914533251 1:148542102-148542124 TTAAGTTGATTGGAAAAATATGG - Intronic
914533786 1:148546816-148546838 TTAAGTTGATTGGAAAAATATGG - Intronic
914534322 1:148551524-148551546 TTAAGTTGATTGGAAAAATATGG - Intronic
914534858 1:148556238-148556260 TTAAGTTGATTGGAAAAATATGG - Intronic
914535393 1:148560955-148560977 TTAAGTTGATTGGAAAAATATGG - Intronic
914535930 1:148565691-148565713 TTAAGTTGATTGGAAAAATATGG - Intronic
914536465 1:148570413-148570435 TTAAGTTGATTGGAAAAATATGG - Intronic
914536824 1:148573601-148573623 TTAAGTTGATTGGAAAAATATGG - Intronic
914585370 1:149056883-149056905 TTAAGTTGATTGGAAAAATATGG - Intronic
914585733 1:149060071-149060093 TTAAATTGATTGGAAAAATATGG - Intronic
914629095 1:149491741-149491763 TTAAATTGATTGGAAAAATATGG + Intergenic
914629628 1:149496504-149496526 TTAAATTGATTGGAAAAATATGG + Intergenic
914630163 1:149501259-149501281 TTAAATTGATTGGAAAAATATGG + Intergenic
914630697 1:149506020-149506042 TTAAATTGATTGGAAAAATATGG + Intergenic
914631228 1:149510781-149510803 TTAAATTGATTGGAAAAATATGG + Intergenic
914632297 1:149520290-149520312 TTAAATTGATTGGAAAAATATGG + Intergenic
914632832 1:149525047-149525069 TTAAATTGATTGGAAAAATATGG + Intergenic
914633367 1:149529776-149529798 TTAAATTGATTGGAAAAATATGG + Intergenic
914633903 1:149534527-149534549 TTAAATTGATTGGAAAAATATGG + Intergenic
914634438 1:149539278-149539300 TTAAATTGATTGGAAAAATATGG + Intergenic
914634971 1:149544015-149544037 TTAAATTGATTGGAAAAATATGG + Intergenic
914635506 1:149548752-149548774 TTAAATTGATTGGAAAAATATGG + Intergenic
914636041 1:149553489-149553511 TTAAATTGATTGGAAAAATATGG + Intergenic
915612594 1:157006525-157006547 TTCCTGGGCTTAGAAAAAAAGGG + Intronic
916339596 1:163716372-163716394 TGTCTTTGCTTGGTAAAACAAGG + Intergenic
916353676 1:163880540-163880562 GCATTTTGCTTGGAATAAAATGG + Intergenic
916520305 1:165557632-165557654 TAATTTAGCTTGCAAAAAAATGG + Intronic
916676457 1:167067829-167067851 TTTCTTTCCTTTAAAAAAAATGG - Intronic
916976649 1:170087641-170087663 TTTCTTTGCTTTGAATAAATTGG - Intergenic
917778385 1:178363472-178363494 TTCCTTTGCTGTGCAAAAAAAGG + Intronic
917785570 1:178452942-178452964 ATACTTTAGTGGGAAAAAAAGGG + Intronic
917852762 1:179079521-179079543 TTTTTTTTTTTGGAAAAAAACGG + Intergenic
918016245 1:180635634-180635656 TTTCCTTGCCTGGAAAAACAAGG - Intronic
920127064 1:203701754-203701776 TCACATTGCTTGGAAAAATGGGG - Intronic
920724146 1:208417862-208417884 TTTCATTGCTTGTAAAACAAGGG + Intergenic
921287286 1:213620705-213620727 TTAGTTTGCATGTAAAGAAATGG + Intergenic
921419969 1:214935021-214935043 TTATGATACTTGGAAAAAAAAGG + Intergenic
921441226 1:215188826-215188848 TTGCTTTGTTTGGAAAAGGAGGG + Intronic
921763754 1:218946479-218946501 TTAATTTGCTTGGAAATGGAAGG - Intergenic
921853245 1:219953107-219953129 TGACAGTGCTTGGAAAACAATGG + Intronic
922254687 1:223883526-223883548 AAACTTTGTTAGGAAAAAAAGGG + Intergenic
922280958 1:224123577-224123599 AAACTTTTCTGGGAAAAAAAAGG - Intronic
924386761 1:243506336-243506358 TTATTTTGCTTGAAGAGAAAAGG - Intronic
1063399592 10:5729675-5729697 TTACTTTTCTTTAAAAAGAATGG + Intronic
1065722463 10:28640146-28640168 TTACTTTGCCTTAAAAAAGAAGG - Intergenic
1065893552 10:30141191-30141213 TTTCTTTGTTTTGAAAAATACGG + Intergenic
1066425622 10:35305087-35305109 TGACATTGCTTGGAGAAAACCGG + Intronic
1066575756 10:36822758-36822780 ATAATCTGCTTGAAAAAAAAAGG - Intergenic
1066719042 10:38317967-38317989 TCATTTTGCCTGGAAAAAATTGG + Intergenic
1066749680 10:38641003-38641025 TTATTTTGCTTGGATCATAATGG + Intergenic
1066966968 10:42276774-42276796 TTATTTTGCTTGGATCATAATGG - Intergenic
1067229335 10:44395834-44395856 TTAGTTTGTATGTAAAAAAAAGG + Intergenic
1067390764 10:45861045-45861067 TTACTCTAGTTAGAAAAAAATGG + Intergenic
1067500707 10:46802805-46802827 TTACTCTTGTTAGAAAAAAATGG - Intergenic
1067593877 10:47537095-47537117 TTACTCTTGTTAGAAAAAAATGG + Intronic
1067640988 10:48045208-48045230 TTACTCTTGTTAGAAAAAAATGG + Intergenic
1067695638 10:48533851-48533873 GTACTTGGCTTAGAAAAAAAAGG + Intronic
1067741589 10:48899626-48899648 TTACATAGCTTGGAATAGAAGGG + Intronic
1067984322 10:51124732-51124754 TTTGTTTGCTTACAAAAAAACGG + Intronic
1068193323 10:53682876-53682898 TTACTTCCCTTTGGAAAAAAAGG - Intergenic
1070115257 10:73522557-73522579 TTATTTTGCTTCTGAAAAAAGGG - Intronic
1070137951 10:73711263-73711285 TTACTCTAGTTAGAAAAAAATGG + Intergenic
1071815326 10:89226181-89226203 TTATATTGCCAGGAAAAAAATGG - Intronic
1071955384 10:90751851-90751873 TTACTTAGCCAGGAAAAAGATGG - Intronic
1072112063 10:92332284-92332306 TTACTTTGCTTAATAACAAAAGG - Intronic
1072820294 10:98550205-98550227 TTACTAGGCTGGGAAAAGAAAGG - Intronic
1072858541 10:98976793-98976815 TTACTTTATTTGGAAAAAATGGG + Intronic
1072877798 10:99191430-99191452 TTACTTTGCCTGCAAACAAATGG - Intronic
1073239937 10:102050555-102050577 TGACTTTTCTTGGATAAAATGGG - Intronic
1073854284 10:107656840-107656862 TGACCCTTCTTGGAAAAAAATGG - Intergenic
1073880451 10:107974397-107974419 TGACTTTGCTTTGTAAAAAATGG - Intergenic
1074160180 10:110830319-110830341 TTCCTTTGCTTGGAATCAAAAGG + Intronic
1074235586 10:111581582-111581604 TTACTTTGCTTGGAAGGAAAAGG - Intergenic
1075265256 10:120995630-120995652 TTTCTTTGTTTGGGAAAATAAGG + Intergenic
1075923958 10:126235754-126235776 TTATTTTTCTTGGAAACCAATGG - Intronic
1076163086 10:128261050-128261072 CTACTTTGCATGGGAGAAAATGG + Intergenic
1076223127 10:128750990-128751012 TTCTTTTGCTTTGAAACAAAAGG + Intergenic
1077951227 11:6959784-6959806 TTACCTTGCTTTTAAAAAAATGG - Intronic
1078396100 11:10983516-10983538 TTTCTTTGCTTGGAAAATGCTGG + Intergenic
1079119842 11:17673996-17674018 TTATTTTCCTTGGGAAATAAGGG - Intergenic
1079226382 11:18609515-18609537 CTACTTTGAAAGGAAAAAAAAGG - Exonic
1079335332 11:19565650-19565672 TTAATTTCTGTGGAAAAAAAAGG - Intronic
1080638742 11:34145993-34146015 TTGCTTTGCTTTGTCAAAAAGGG - Intronic
1080702525 11:34656310-34656332 TAACTTTGCATGCCAAAAAAGGG + Intronic
1080907958 11:36565612-36565634 TTAATTTGCTTGGAACAACATGG + Intronic
1081027109 11:38029213-38029235 TTCCTTTTCTTGGAAAACACCGG + Intergenic
1081221332 11:40466463-40466485 ATACTATGCTTGGAAAATAAAGG + Intronic
1082602676 11:55178410-55178432 TTCTTTTGATTGGAGAAAAAGGG - Intergenic
1082604196 11:55203277-55203299 TTCTTTTGATTGGAGAAAAAGGG - Intergenic
1084858412 11:72003265-72003287 TGACTTTGCTTTAAGAAAAAAGG + Exonic
1086014055 11:82142961-82142983 TTGTTTTACTTGGAAAACAATGG - Intergenic
1086599550 11:88616061-88616083 TTTCTGTGCCTGAAAAAAAATGG + Intronic
1087324330 11:96702315-96702337 TTATGTTCCTTTGAAAAAAATGG + Intergenic
1087539002 11:99491123-99491145 CTTCTTTGCTTGGAAACTAAAGG - Intronic
1087687306 11:101279588-101279610 TTACTTTTCATGTAACAAAAAGG + Intergenic
1088225845 11:107619027-107619049 TTAATTTGCTTAGAGAAAACAGG - Intronic
1088252517 11:107873455-107873477 TTATTATGCTTGGAAATTAAGGG - Intronic
1088292309 11:108253469-108253491 TTCCTCTGCTTGGTGAAAAAAGG + Intronic
1088302125 11:108369799-108369821 TTATTTTGATGGGAACAAAATGG + Intronic
1088478940 11:110274332-110274354 TTATCTTGCTTTTAAAAAAATGG + Intronic
1088655830 11:111999042-111999064 TTACTTTGGTTCCATAAAAAAGG - Intronic
1088712596 11:112521973-112521995 TTACTTTATATGGCAAAAAAAGG + Intergenic
1088838785 11:113604447-113604469 TTTCTTTTCTTGGAGAACAAAGG - Intergenic
1089701509 11:120246991-120247013 TGACTTTGCTTTGGAAAGAAGGG + Intronic
1090458881 11:126872318-126872340 TTAATTTGCATGTAAATAAAGGG + Intronic
1091872695 12:3907935-3907957 TTACTTTGCTCGAAAGATAACGG - Intergenic
1092970735 12:13692424-13692446 TTACATTGATGAGAAAAAAATGG + Intronic
1093444753 12:19244003-19244025 TTACTTTCATTGTAATAAAAAGG - Intronic
1093562728 12:20561527-20561549 TTACTTTGATTCGCAAAACATGG + Intronic
1094276298 12:28679802-28679824 TGGCTTTCCTTGGAAAAAAGTGG + Intergenic
1095241442 12:39864413-39864435 TTACTTTGCTTGGAACACAGAGG + Intronic
1095474151 12:42568130-42568152 TCACTATGCTTTGAAAAATAGGG + Intronic
1095502237 12:42852962-42852984 GTACTTTGTTCTGAAAAAAAAGG + Intergenic
1095622804 12:44278753-44278775 TTATTTTGCTTGGATAAGCATGG + Intronic
1095825298 12:46524761-46524783 TTCCTATGCTTGGAAAAATCTGG - Intergenic
1096931717 12:55217068-55217090 TTAGTTTCCTGGGAAAATAAGGG + Intergenic
1098378991 12:69848394-69848416 ATATTTTGTTTGGATAAAAAAGG - Intronic
1098424857 12:70351114-70351136 TTGCTTTTAGTGGAAAAAAAAGG - Intronic
1099142599 12:78997485-78997507 ATACTTTGCTTTTAAAAATAGGG + Intronic
1099833306 12:87873637-87873659 TTTCTTTGCTTACAAAATAAAGG + Intergenic
1100011464 12:89959256-89959278 TTACTTTTCTTCTAAAATAAGGG - Intergenic
1100250220 12:92813342-92813364 TTCCTTTGCTAAGAAAGAAAAGG + Intronic
1100595346 12:96066817-96066839 CTACTTTGCCTGAAAAAAATGGG - Intergenic
1100621963 12:96285324-96285346 TTCCTTAGCTTGAAAATAAAAGG + Intronic
1101185724 12:102276555-102276577 TTGCTTTGCTTGGAGAAGAAGGG - Intergenic
1101519268 12:105466476-105466498 TTAATTAGCTTTGAAAAAGATGG - Intergenic
1102539869 12:113610804-113610826 TTGCCTTGCTTGGAGAAGAAAGG + Intergenic
1103276898 12:119719367-119719389 TTACTATACATGGAAAAAAAAGG + Intronic
1103855236 12:123963535-123963557 TTCTTTTGCTTGGAAGAAAAAGG + Intronic
1106275102 13:28197170-28197192 TTCCTTGGCTAGGAAAAAGAAGG - Exonic
1106444508 13:29814567-29814589 TTACAGTGCTTGGAAAAGAGTGG - Intronic
1106964317 13:35041260-35041282 TTACTTTGATTTAAAATAAATGG + Intronic
1107199955 13:37702888-37702910 TTACATTGCTTAGACAAAAGAGG + Intronic
1107280792 13:38732448-38732470 TTAGTATGCTTTGAAAATAATGG - Intronic
1107467325 13:40663498-40663520 GTACTTTGAATGCAAAAAAAGGG + Intronic
1107509356 13:41067261-41067283 TTACATTGCTTTGAAAAAATGGG - Intronic
1108776338 13:53769464-53769486 TTACTTTACTTGGAAAAAAAAGG - Intergenic
1108960614 13:56223129-56223151 TTAGTTTTCTTTGAAAAACATGG - Intergenic
1109126419 13:58524104-58524126 TAACTTTGCTGGAAAGAAAATGG - Intergenic
1109147444 13:58797960-58797982 TTACCTTGTATAGAAAAAAAAGG + Intergenic
1109225968 13:59695990-59696012 TTCCTTTGTTTGGAATATAACGG - Intronic
1109375219 13:61484476-61484498 GCACTTGGCTTGGAACAAAAGGG - Intergenic
1109559798 13:64031932-64031954 ATGCTTTGCTTTAAAAAAAAAGG + Intergenic
1109852489 13:68085090-68085112 GAACTTTGCTTTGAAACAAAGGG + Intergenic
1109909630 13:68892400-68892422 GTAATTATCTTGGAAAAAAAAGG - Intergenic
1109966682 13:69708232-69708254 TAAATTTGCTAGGAAAAAAAAGG + Intronic
1110094458 13:71499048-71499070 TGAAATTTCTTGGAAAAAAATGG + Intronic
1110095790 13:71518566-71518588 TTCCTTTGCTTTCAAAATAAGGG + Intronic
1110959168 13:81598850-81598872 CCATTTTGCTTGGAAAAAAATGG + Intergenic
1110984324 13:81944864-81944886 TTAATATGCATGGAAATAAAGGG + Intergenic
1111227278 13:85290176-85290198 TTTCGTTGCTTGGAAAACACTGG + Intergenic
1111596843 13:90422451-90422473 GTACTTGGATTGGAAATAAAAGG - Intergenic
1112044740 13:95584936-95584958 TAATGTTGCTTAGAAAAAAATGG + Intronic
1112414995 13:99196762-99196784 TTAATTTGGTTGTAAATAAAAGG + Intergenic
1113165507 13:107436253-107436275 TCACTTTGCTGAGAAAATAAAGG + Intronic
1113637535 13:111930014-111930036 TTACTCTACTTGTAAAAAATTGG - Intergenic
1113897019 13:113770974-113770996 TTTCTTTCCTTTTAAAAAAATGG + Intronic
1114828920 14:26114574-26114596 TTAATTAGCTTGCAAAAATATGG - Intergenic
1114855744 14:26440424-26440446 ATACATAGCTTGGACAAAAAAGG - Intergenic
1115011887 14:28558707-28558729 TTACTTTGCTTCCACAAAATGGG + Intergenic
1115203639 14:30878320-30878342 AAAATTTGCCTGGAAAAAAATGG - Intronic
1115645002 14:35362910-35362932 TTACTTTGCTTGATAATGAAAGG - Intergenic
1116631339 14:47338704-47338726 TTGCTTTCTTTGGAAATAAAAGG + Intronic
1116971842 14:51074633-51074655 TTTCCTTGCTAGGAAAGAAAAGG - Intronic
1117314194 14:54557853-54557875 TGAAATTGCTTGGAAAGAAAGGG + Intergenic
1117499725 14:56339720-56339742 TCATTTTGCTTGGAGAAAGAAGG - Intergenic
1117731133 14:58722975-58722997 TTATTTTGCTTGGCAAATTATGG + Intergenic
1118343404 14:64915143-64915165 TTACTTTGCTAGGCCAGAAAGGG + Intronic
1119451467 14:74714857-74714879 TTTCTTTACTAGGAAGAAAAAGG - Exonic
1120204777 14:81576016-81576038 TAGCTTTGCCAGGAAAAAAAAGG - Intergenic
1120327997 14:83053557-83053579 TTAATGTTCTTGGAAAATAAGGG + Intergenic
1120660549 14:87244751-87244773 TTACGTTGGTTGTATAAAAAGGG + Intergenic
1122338481 14:101008973-101008995 TTTCCTTGCTGGGAAAAAAATGG - Intergenic
1124216761 15:27813533-27813555 TTACTCTGCTTTGAAAGTAAAGG - Intronic
1124460689 15:29888499-29888521 TTATTTTGGTTGGAAAAAATTGG - Intronic
1124902161 15:33834527-33834549 TAACTTTGCCTGGAAACAATAGG + Intronic
1126115834 15:45206833-45206855 GTACTTTTCCTGGAAAAGAAAGG + Intergenic
1126299647 15:47181999-47182021 TTACTTTATATGGAAGAAAATGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126793296 15:52240127-52240149 TTACTATTGTTGGTAAAAAATGG + Intronic
1126970693 15:54108736-54108758 TTACTTTGTTTGGAAAATAGGGG + Intronic
1127070700 15:55286054-55286076 TTGCTTCTCTTAGAAAAAAATGG + Intronic
1127099425 15:55550193-55550215 ATACTTTGCAAGGAAAAAACAGG - Intronic
1127471315 15:59293131-59293153 TTATTCTGCTAGGAAAAGAAGGG + Intronic
1127480604 15:59373343-59373365 TGAATTTCCTTGGAAAACAAAGG + Intronic
1127622059 15:60743887-60743909 TGACTCTGATTGGAAAAATAAGG - Intronic
1127949576 15:63791844-63791866 TTATTTAGCTTTGAAATAAATGG - Intronic
1129140210 15:73591107-73591129 TTTCCTTGCTTGGGAAAAAAAGG + Intronic
1129225208 15:74166157-74166179 TCACTCTGCTGGGAAAAACAAGG - Intergenic
1130143270 15:81250889-81250911 ATACTTCTCTTGGATAAAAAGGG - Intronic
1130745967 15:86654304-86654326 TTATATAGCTTTGAAAAAAATGG - Intronic
1131782821 15:95878075-95878097 GTAATTTGCATGGAATAAAATGG + Intergenic
1131825030 15:96313730-96313752 TTCTTTTACTTGGAAAATAATGG + Intergenic
1134337219 16:13311670-13311692 TTACTTCGCTTTCAAATAAATGG + Intergenic
1135777463 16:25269307-25269329 TTACTTAACTTGGAAATAACCGG - Intergenic
1135878069 16:26223622-26223644 TTACTTAGGCTGCAAAAAAATGG + Intergenic
1136292935 16:29286748-29286770 CTACTTTACACGGAAAAAAAGGG + Intergenic
1136733036 16:32436149-32436171 TTATTTTGCTTGGATCATAATGG - Intergenic
1137387147 16:48052130-48052152 TTGCTTTGCTTGGAGAAGAGAGG + Intergenic
1137819978 16:51435036-51435058 TTACCTTGCCTGTAAAATAAGGG - Intergenic
1138879337 16:60991646-60991668 TTAGTTTGCTGAAAAAAAAATGG + Intergenic
1139388230 16:66588229-66588251 CACCTTTGCTTGGAAAAGAATGG + Exonic
1139831006 16:69798151-69798173 TTACCTTTCTTGGAAAGGAATGG + Intronic
1140164372 16:72534146-72534168 TTATTTGGCTAAGAAAAAAAGGG + Intergenic
1140491691 16:75342482-75342504 TTTGTTTACTTGGAACAAAAGGG + Intronic
1140649721 16:77074100-77074122 TTAATTAACTTGGAATAAAAGGG + Intergenic
1141391679 16:83669739-83669761 TTACTTTTCTTTGAACACAAGGG + Intronic
1203020045 16_KI270728v1_random:393454-393476 TTATTTTGCTTGGATCATAATGG + Intergenic
1203038380 16_KI270728v1_random:666612-666634 TTATTTTGCTTGGATCATAATGG + Intergenic
1142909001 17:3071327-3071349 TTACTCAGCTTGTAAAAGAATGG + Intergenic
1142925561 17:3232915-3232937 TTACTCAGCTTGTAAAAGAATGG - Intergenic
1144354987 17:14436715-14436737 TTTCTTTTTTTGGAAGAAAAAGG + Intergenic
1144400597 17:14895401-14895423 TTACTTTGTGGGGAAAAAGAAGG + Intergenic
1146092034 17:29889033-29889055 TTAGTTTTCTTAAAAAAAAATGG + Intronic
1148760830 17:49999090-49999112 GGACTTGGCTTGGAAAAACAGGG + Intergenic
1149107552 17:52987665-52987687 TTACAGTCCTGGGAAAAAAAAGG - Intergenic
1149193654 17:54093553-54093575 TGACTTTTCTTGCCAAAAAATGG - Intergenic
1150362138 17:64545654-64545676 TTCCTTTTCAAGGAAAAAAAAGG - Exonic
1150589340 17:66548621-66548643 TTGCCTTATTTGGAAAAAAAGGG + Intronic
1150892843 17:69174184-69174206 ATACTTTGCTTAGAAGAGAATGG - Intronic
1151040139 17:70850008-70850030 TTACTTTCATTGAAAAATAAAGG + Intergenic
1151058576 17:71063208-71063230 TTACTGTGCTTAGGATAAAATGG + Intergenic
1153732671 18:8029990-8030012 TTACTTCGCAGGGAAAAAGAAGG - Intronic
1154341965 18:13510954-13510976 TTTATCTGCTTGGAAAAAAATGG + Intronic
1155075478 18:22350185-22350207 TTACTTTGCTTCAAAGGAAATGG + Intergenic
1155546531 18:26921568-26921590 TTGCTGTGATTGGAAGAAAATGG - Intronic
1155989376 18:32263682-32263704 TTTCTTTGCTTGGAAAACTTGGG - Intronic
1156657644 18:39308019-39308041 TTACTTAGCCTTGTAAAAAATGG - Intergenic
1158646149 18:59249468-59249490 TTCCTTGGCTGGGAAATAAAGGG - Intergenic
1159006381 18:63016497-63016519 TTCCTTTGGTGGGAAAAAAAAGG - Intergenic
1159242152 18:65755285-65755307 TTGCTTTACTTTGAACAAAATGG - Intronic
1159799215 18:72876343-72876365 TTGTCTTGCTTGGATAAAAAAGG + Intergenic
1159842015 18:73409283-73409305 TTAATTTGCTAGGACAAAAGTGG - Intergenic
1160253416 18:77224594-77224616 TTTCTTTACTTGGAAAGAGAGGG - Intergenic
1161092078 19:2366064-2366086 TGAAACTGCTTGGAAAAAAAGGG + Intergenic
1161450201 19:4341551-4341573 TTAATTTTCTTGTAAAAGAAGGG - Intronic
1164144274 19:22501338-22501360 TTTTTTTGCCTGGCAAAAAAAGG - Intronic
1164969910 19:32522961-32522983 TTTCTTTGCTTGAAAACTAAAGG - Intergenic
1202676003 1_KI270711v1_random:7365-7387 TTAAATTGATTGGAAAAATATGG - Intergenic
926414429 2:12634961-12634983 TTGCTTTGCTTGGGACAAAATGG + Intergenic
926425200 2:12733567-12733589 TTACTTTGTTTTGAGAAATAAGG + Intronic
927387234 2:22548991-22549013 TTACTGTGCATGAAAAAATAAGG + Intergenic
928840961 2:35604038-35604060 TTACCTTGCTTGGGAAGAGAAGG + Intergenic
929260522 2:39861985-39862007 TTAGTTTGTTTGGTGAAAAAAGG + Intergenic
929295582 2:40242895-40242917 TAACTTTGCTTTTATAAAAATGG - Intronic
929619336 2:43338692-43338714 TTACTTAGCCTGGAAAAGGAAGG - Intronic
930232268 2:48855351-48855373 CCACTTTGCTTTGAAGAAAAAGG - Intergenic
931160410 2:59683933-59683955 TTCCTCTGCAGGGAAAAAAATGG + Intergenic
932025580 2:68128879-68128901 TTAATTTGCAAAGAAAAAAATGG - Intronic
932643074 2:73470514-73470536 CTATTGTGCTTGGGAAAAAAAGG + Intronic
932961992 2:76423621-76423643 TTAATATGGTTGGAAACAAAAGG + Intergenic
934850221 2:97694568-97694590 TTACTCCGCTTCGAAAAGAAAGG - Intergenic
935274946 2:101468060-101468082 TTACTTTCCTTGGGAACTAAAGG + Intronic
935408366 2:102733742-102733764 TTTTTTTTTTTGGAAAAAAATGG - Intronic
937001999 2:118476372-118476394 CTACTTTTCTTGGCCAAAAATGG + Intergenic
937055023 2:118927353-118927375 TTCCTTAGCTTGGCAAATAACGG - Intergenic
937352158 2:121172850-121172872 CTACTTTGGTTGGAAAAAGATGG - Intergenic
938692018 2:133800496-133800518 ACCCTTTGCTTGGAAAAAGATGG + Intergenic
938985962 2:136576583-136576605 ATACTTAGCATGAAAAAAAAAGG + Intergenic
940019620 2:149143198-149143220 AAACTTTGCTGGGAAATAAATGG - Intronic
940313438 2:152303431-152303453 TTTCTTTGCTTGGAAATTAGGGG + Intergenic
940361772 2:152803855-152803877 TTATTTTGCTATGTAAAAAATGG - Intergenic
940461772 2:153973111-153973133 TTTCCTTGTTAGGAAAAAAAAGG - Intronic
940646966 2:156401805-156401827 TCACTTTCCTTGGAAACTAAGGG - Intergenic
940807424 2:158203926-158203948 TTCCTTTGTTTAGAATAAAAAGG + Intronic
941473495 2:165919728-165919750 TTATTTTCCTTGTCAAAAAAAGG + Intronic
941591358 2:167424067-167424089 TGAATCTGCTTGGAAAAGAATGG - Intergenic
942401621 2:175609303-175609325 TTTCTTTCCTTGGGAACAAACGG - Intergenic
943032261 2:182699999-182700021 TCTCTTCTCTTGGAAAAAAATGG + Intergenic
943467043 2:188240702-188240724 TCACAATGATTGGAAAAAAATGG - Intergenic
944070608 2:195663961-195663983 TCACTTTATTTGGAAAAAACGGG - Intronic
944542085 2:200763796-200763818 TTACTGTGATTAGAATAAAATGG + Intergenic
945572004 2:211479903-211479925 TTACCTTTCTCTGAAAAAAAGGG - Intronic
946142615 2:217704436-217704458 ACACTTTGCATGCAAAAAAAGGG + Intronic
946257236 2:218452894-218452916 TGATTTTGCTTGGAAATAATTGG - Exonic
946494956 2:220186791-220186813 TTACCTTGCTAGAAAACAAAGGG + Intergenic
946797911 2:223375711-223375733 ATACTCTTCTAGGAAAAAAAAGG + Intergenic
946804554 2:223458182-223458204 TTACTCTGACAGGAAAAAAAAGG + Intergenic
946954994 2:224920011-224920033 TTACTTTGCATGCAAAGCAACGG - Intronic
1168743665 20:217042-217064 TTCCCTTGCTTTTAAAAAAACGG + Intergenic
1169955423 20:11097594-11097616 TTACTATGCTTGGGCCAAAAGGG + Intergenic
1170039134 20:12021892-12021914 TTACTTTGCTTATTAATAAATGG + Intergenic
1170175331 20:13462478-13462500 TTACCATGCTTAGGAAAAAAGGG - Intronic
1171108666 20:22460232-22460254 TTAAGTTGCATGGAAAAGAAGGG - Intergenic
1172551040 20:35800019-35800041 TTCCTTTTGATGGAAAAAAAAGG - Intronic
1172642023 20:36446267-36446289 TTTCTTTCCTTGTAAAATAAAGG + Intronic
1173287827 20:41689026-41689048 TTACTTTCTTGGGAAAATAAGGG + Intergenic
1173699089 20:45051215-45051237 CAATTTTGCTTGGCAAAAAAAGG - Intronic
1174617218 20:51844739-51844761 TTAATTTCATTGGCAAAAAAAGG - Intergenic
1174881605 20:54285209-54285231 TTACTTTTCTTAGAAAACAGGGG - Intergenic
1177064853 21:16417691-16417713 TTTCTTACATTGGAAAAAAAGGG + Intergenic
1177254873 21:18648439-18648461 TTGCTCTGGTTGGGAAAAAATGG - Intergenic
1177404897 21:20653469-20653491 TTATATTCCTTGGAATAAAATGG - Intergenic
1177588324 21:23128344-23128366 TTACCTTACATGGCAAAAAAGGG - Intergenic
1177674291 21:24275817-24275839 TTACTTTGTCAGGGAAAAAAAGG + Intergenic
1178515881 21:33246698-33246720 TTACTTTGGAAAGAAAAAAATGG - Exonic
1178709766 21:34906011-34906033 TTATTTTGCTATGAACAAAAGGG + Intronic
1179106672 21:38406627-38406649 TTGCTTTGCTTTTAACAAAATGG + Intronic
1180539420 22:16428976-16428998 TTATTTTGCTTGGATCATAATGG + Intergenic
1180577358 22:16791271-16791293 TTACGTTGAGTGAAAAAAAATGG + Intronic
1181969408 22:26678978-26679000 TTATTTTGCTTTGGAAAATACGG - Intergenic
1182125877 22:27815588-27815610 CTAGTTTGCATGGAAGAAAAAGG + Intergenic
949736405 3:7177121-7177143 ATACTTTGGTTTAAAAAAAAAGG - Intronic
951133879 3:19080597-19080619 ATAACTTGCTTGGGAAAAAATGG - Intergenic
951610478 3:24486802-24486824 TTATTTTTCTTTAAAAAAAAAGG - Intronic
952083401 3:29788207-29788229 TTTTTTTTTTTGGAAAAAAATGG + Intronic
952227035 3:31388213-31388235 ATACTTTGTTTTAAAAAAAATGG + Intergenic
952598351 3:35046570-35046592 TTATTTTACTAGGTAAAAAAAGG - Intergenic
952642788 3:35617802-35617824 TTACCTTATTTGGGAAAAAAGGG - Intergenic
952746205 3:36783583-36783605 TTACTTTGATTAAAAAAACAAGG - Intergenic
953012826 3:39043833-39043855 TTACATTGCTTGTAATAAAAAGG + Intergenic
953095236 3:39768301-39768323 TTACTCTACTTGAAAACAAAGGG - Intergenic
954526885 3:51279818-51279840 AAACTTTCCTAGGAAAAAAAGGG + Intronic
955133616 3:56194282-56194304 TAACTTTATTTGGAAAAAAAAGG + Intronic
955992403 3:64642274-64642296 TTAGTTTACTTGGAAAAACCAGG + Intronic
956276434 3:67506686-67506708 TTGCTTTGCATGAAGAAAAATGG - Intronic
956831624 3:73055093-73055115 TTATTTTCCTTGGAATTAAAGGG + Intronic
957349373 3:79003158-79003180 TTCCTTTGCTGGGATAGAAATGG + Intronic
957369014 3:79266783-79266805 TCACTTTGTTTGGTATAAAATGG - Intronic
957411968 3:79853006-79853028 TTACTTTCTTTAGAAATAAATGG - Intergenic
957530876 3:81439448-81439470 TTTCTTTATTTGGAAAATAAGGG - Intergenic
957550940 3:81703599-81703621 TAATTTTGTTTGGAAAAAACTGG + Intronic
957675974 3:83365020-83365042 TTACCTTATTTGGAAAAAAGAGG + Intergenic
958850348 3:99317584-99317606 TTATTGTGCTAGGAAAAAAAAGG + Intergenic
958945959 3:100362291-100362313 TTACTTTAGTTGGCAAAAAATGG - Intergenic
959186451 3:103052943-103052965 TTACTTAGTATGTAAAAAAATGG - Intergenic
959350224 3:105252803-105252825 TTCTTTAGTTTGGAAAAAAAAGG + Intergenic
960138030 3:114125156-114125178 TTATTTTGCATGGAAAAACCTGG + Intergenic
960308140 3:116087659-116087681 TTACTTGGCTTAGAAAATACAGG - Intronic
960466135 3:117998141-117998163 TTAAGTTACTTGGAAATAAAAGG + Intergenic
960476525 3:118136562-118136584 TTATTTTCACTGGAAAAAAAAGG + Intergenic
962165569 3:133044287-133044309 TTTCCTTGTTTGGAAAATAAGGG + Intronic
962298572 3:134216147-134216169 TTCCCTTACTTGGAAACAAATGG + Intronic
962481914 3:135805315-135805337 TTACTTTGCTAGGTGAAAACAGG - Intergenic
962500994 3:135992221-135992243 TTACTTTGCCTGGAAAACATAGG - Intronic
963536308 3:146532886-146532908 TTACTTTTCTTAGAAATACAGGG + Intronic
963713349 3:148773409-148773431 TTCCTTAGCTTGAAAAAATAGGG + Intergenic
964006637 3:151837090-151837112 TTACTTTACTTGTAAGAAAGAGG - Intergenic
964470768 3:157053016-157053038 TTACATTGAATGGAAAAGAATGG + Intergenic
964515900 3:157507271-157507293 TTCCTTTGCTTGGCACACAAGGG + Intronic
964890931 3:161533557-161533579 CTGCTTTGAATGGAAAAAAATGG - Intergenic
965191186 3:165531275-165531297 GTACGTTGATTGGAAAAGAATGG - Intergenic
965512699 3:169586163-169586185 CTACTTTACTTGCAAAGAAATGG - Intronic
965979315 3:174667877-174667899 TTACTTTTCTTAGAAAAATGGGG + Intronic
966221167 3:177552682-177552704 TTAGTTTGATTGGAAAGAAGGGG + Intergenic
966283213 3:178260087-178260109 TTACTTTTCTTGCAGAAAATGGG + Intergenic
967263287 3:187666691-187666713 TTTCTTTTAATGGAAAAAAATGG - Intergenic
967383819 3:188889988-188890010 TTTTTTTCCTTGGAAACAAATGG + Exonic
967613112 3:191531958-191531980 TTATTTTGTTTGAAAAAGAAAGG - Intergenic
967893595 3:194380548-194380570 TTAATTTGCTAGGAAGGAAATGG - Intergenic
968062255 3:195734499-195734521 GTACTTTGTTTTGTAAAAAAGGG + Intronic
969136230 4:5031351-5031373 TTACTTTCCTTGGAAAATGAGGG + Intergenic
970290785 4:14569842-14569864 TTAATTGGCTTCGAAAATAAGGG - Intergenic
970545439 4:17125205-17125227 ATACATTGCTAGGAACAAAAAGG + Intergenic
970764137 4:19525976-19525998 TTAATTTACTTGTAAAAAAATGG - Intergenic
970858467 4:20675124-20675146 TGACCTTATTTGGAAAAAAAAGG + Intergenic
971504373 4:27350081-27350103 TTTCTTTGCTGGCAAAAGAAAGG + Intergenic
971903777 4:32698773-32698795 TTACTTTGCTTATGAAGAAATGG + Intergenic
972075725 4:35083991-35084013 TTAACTTGCAGGGAAAAAAATGG + Intergenic
972227261 4:37027346-37027368 TTACATTTATTGGAATAAAATGG - Intergenic
972498485 4:39656152-39656174 TTACTCTGCTTGCAAACAACTGG - Intergenic
972856329 4:43112003-43112025 TTCCTTTTCTTAAAAAAAAAAGG + Intergenic
973816658 4:54625570-54625592 TTGCTTTGGTTGGAATGAAAAGG + Intergenic
973867371 4:55126930-55126952 AGAATCTGCTTGGAAAAAAAAGG - Intergenic
974370314 4:61008483-61008505 TTACGTTCCTTGTTAAAAAATGG + Intergenic
974459564 4:62169828-62169850 TTCCTAGGCTTTGAAAAAAATGG + Intergenic
974581676 4:63811730-63811752 TTACTTTTCTTTCAAAAAACAGG + Intergenic
974656566 4:64831282-64831304 TAACTTTACTTGGAAATAATAGG - Intergenic
974822377 4:67083549-67083571 TTAGATTGCTTGGAAAGGAAAGG - Intergenic
974916007 4:68179216-68179238 TTACTCTTCTGGGAAAGAAAGGG - Intergenic
975061467 4:70007671-70007693 TTAAATTTCTAGGAAAAAAATGG + Intergenic
976501172 4:85791100-85791122 TTTCTTTGTTTGGTTAAAAAGGG - Intronic
976737755 4:88328060-88328082 AGACTGTGTTTGGAAAAAAATGG + Intergenic
977194702 4:94044702-94044724 TTACTGTACCTGGAAAAAACAGG + Intergenic
977196206 4:94063472-94063494 TAAATTTGCTTAGAAAAAAATGG + Intergenic
977775127 4:100908855-100908877 TTGCTTTGATTGGAGTAAAATGG + Intergenic
977944881 4:102901149-102901171 TTATTTTGCTTGGATCATAATGG + Exonic
978383369 4:108154478-108154500 TTTTTTTGCTTGAAAAAGAAGGG - Intronic
978505285 4:109450036-109450058 TTACTTTGTTTGTAGAAACAAGG - Intronic
978682606 4:111400012-111400034 TTACTTTCTTTGGTAATAAAGGG + Intergenic
978863491 4:113479922-113479944 TTACTTTTGTAGGTAAAAAATGG + Intronic
978906772 4:114014374-114014396 TTACTTTTTTTGTAACAAAAAGG - Intergenic
979509347 4:121534464-121534486 TGACTGTGCTTGAAAAATAATGG + Intergenic
980320021 4:131259416-131259438 TTACTTTGGCTGTGAAAAAATGG - Intergenic
980854358 4:138421702-138421724 TTACTTTGCTTGCAAGGCAAAGG + Intergenic
980922569 4:139101899-139101921 TCATTTTGTTTGGAAAAACAAGG - Intronic
981428818 4:144636272-144636294 TAAGTTTGCCTAGAAAAAAATGG - Intergenic
981541474 4:145850881-145850903 TGACTTTATTTGGGAAAAAAAGG + Intronic
981725301 4:147841217-147841239 TAGCTCTGCTTGGAAACAAAAGG - Intronic
981871843 4:149496351-149496373 TTACCTTACATGGAAAAAAGAGG + Intergenic
981934659 4:150226588-150226610 TTTCCATGGTTGGAAAAAAAAGG + Intronic
982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG + Intergenic
982423028 4:155220499-155220521 TTATTTTTCCTGGAATAAAAAGG - Intergenic
982830342 4:160051813-160051835 TTACTTTGTTTTGAAAGAAGAGG - Intergenic
983269167 4:165540546-165540568 TTATTTTGCTAAGAAAGAAATGG - Intergenic
983294954 4:165855220-165855242 TTAATCAGCTTGGAAAAAAATGG - Intergenic
983347488 4:166545719-166545741 TCACTTGACTTGGAAAAATAAGG - Intergenic
983502414 4:168514142-168514164 TTATTTGATTTGGAAAAAAATGG + Intronic
983740919 4:171132595-171132617 CTATTTGGCTTGGAAAAACAAGG + Intergenic
984293767 4:177828318-177828340 TTGCTTTCCTTGGAATAATATGG - Intronic
984525341 4:180851553-180851575 TAAGTTTGCTGGGGAAAAAAAGG - Intergenic
984764915 4:183393035-183393057 TTACTTTACCTGGAAAAAAATGG - Intergenic
985044927 4:185930738-185930760 TTTCATTGCTTGGAAACAAGTGG - Intronic
985196117 4:187431753-187431775 ATAGTTTGTTTGGAAAAATATGG - Intergenic
986573031 5:9184768-9184790 TTACTTTGCTTGGAAAAAAAAGG - Intronic
987528455 5:19082825-19082847 ATACTTTCTCTGGAAAAAAATGG - Intergenic
988075483 5:26348242-26348264 TTTCTTGGTTTGGAAGAAAAAGG + Intergenic
988188249 5:27896429-27896451 TTACTTTTTTTAAAAAAAAAGGG - Intergenic
988203668 5:28104382-28104404 TAAATATGCTTGTAAAAAAATGG + Intergenic
988446398 5:31290661-31290683 GTTCTTTTCTTGGGAAAAAAAGG - Intronic
988558992 5:32263345-32263367 TCATTCTGCTTGGATAAAAATGG - Intronic
989191033 5:38669892-38669914 TACCTTTGCTCAGAAAAAAAGGG - Intergenic
989240467 5:39197311-39197333 TTTATTTGCTTGTAATAAAATGG - Intronic
989813691 5:45709986-45710008 TTATTTTTTTTGAAAAAAAAAGG + Intergenic
990091478 5:52056393-52056415 TTACTATCCTAGGAAAAAGATGG + Intronic
990763616 5:59158230-59158252 TTATTTTGCTTGCTAAAATATGG - Intronic
991968677 5:72117140-72117162 TAACTTTGCTTTGAGAAAAAAGG + Intronic
992044917 5:72877743-72877765 TTACTTTACTTTTAGAAAAATGG - Intronic
992488126 5:77215435-77215457 TTAATGTGCTGGGAAAAGAAGGG - Intronic
992928309 5:81614508-81614530 TTATTTTCCTTGGAAGAACAAGG + Intronic
993188411 5:84649612-84649634 TGCCATTGCTTGGAAACAAAAGG + Intergenic
993968329 5:94386127-94386149 TTATTTTGCTAGGAAGCAAAAGG - Intronic
994224930 5:97240688-97240710 TTACTATGCCTGGAGAACAAGGG + Intergenic
994362105 5:98863834-98863856 TTACTTAGCTTCTACAAAAATGG + Intronic
994442164 5:99822040-99822062 TTATATTTCTGGGAAAAAAATGG + Intergenic
994988277 5:106965801-106965823 TAAGTTTGCTTGGACCAAAAAGG + Intergenic
994998118 5:107090972-107090994 TTATTTTCTTTGGAAAAAAGAGG + Intergenic
995216082 5:109596252-109596274 TTACTTAGCTGAGAAAACAAAGG + Intergenic
995560265 5:113373691-113373713 TTCCATGGGTTGGAAAAAAATGG + Intronic
995659521 5:114465304-114465326 TTACTTTGCTTAAAAAAGAGAGG + Intronic
996457963 5:123706925-123706947 TTACTTTTTTTGAGAAAAAATGG + Intergenic
997276087 5:132592341-132592363 TTACATTGCTAGCATAAAAATGG + Intronic
997707105 5:135966207-135966229 TTACTTTCCCATGAAAAAAATGG + Intergenic
998305731 5:141074978-141075000 TGATTTTTCTAGGAAAAAAAGGG - Intergenic
1000008935 5:157213726-157213748 AGATTTTGGTTGGAAAAAAAAGG - Intronic
1000078514 5:157820017-157820039 TTTCTTTGGTTGAAAAACAATGG + Intronic
1000759534 5:165205231-165205253 TTCCTTTGGTAGGAAATAAATGG - Intergenic
1000862898 5:166477454-166477476 TTACTGTACTAGAAAAAAAAAGG + Intergenic
1000969494 5:167698028-167698050 TTTATTTTCTTGGAAAATAAAGG - Intronic
1001072728 5:168600815-168600837 TTAGTTTTCTTAAAAAAAAAAGG + Intergenic
1001170823 5:169417436-169417458 GTACTTTGCTTTAAAAAAGATGG - Intergenic
1001992644 5:176130723-176130745 AAACATTTCTTGGAAAAAAAAGG - Intronic
1002224236 5:177707426-177707448 AAACATTTCTTGGAAAAAAAAGG + Intergenic
1002352278 5:178591398-178591420 TTATTTTTCTTAAAAAAAAATGG - Intergenic
1002487527 5:179549897-179549919 TTTCTTCACTTGGAAAAGAAAGG - Intergenic
1002572059 5:180145650-180145672 TTTCTTTGCTTGAAAAAAGTGGG - Intronic
1003740678 6:8935120-8935142 TTACTTTTCTTGGCAGGAAAGGG - Intergenic
1004026957 6:11828118-11828140 TGACTTTTCTTTGAAGAAAAAGG + Intergenic
1004321382 6:14634174-14634196 ATGCCTTTCTTGGAAAAAAAAGG - Intergenic
1004763032 6:18692051-18692073 TTGCTTTACTTGGAAAGAAAAGG - Intergenic
1005802598 6:29442138-29442160 TGACTTTGCTGGGAAGAGAAGGG + Intronic
1005927426 6:30455104-30455126 TCAAGTTGTTTGGAAAAAAAGGG - Intergenic
1005930943 6:30483388-30483410 TCAAGTTGTTTGGAAAAAAAGGG - Intergenic
1005939747 6:30552197-30552219 TTACTTTGATTTTAAAAATAAGG - Intronic
1006068234 6:31477968-31477990 TTTCTTTTCTTGGAATGAAAGGG - Intergenic
1007239467 6:40414611-40414633 TTTCTTTGATTGGAAATAAATGG - Intronic
1008013634 6:46492926-46492948 ATGCTTTACTTGGAAAGAAAGGG - Intergenic
1008431034 6:51417076-51417098 TCACTTTGCATGGAAGAAGAAGG + Intergenic
1009539058 6:64927141-64927163 TAACTTTGTGTGGAAAAAAAAGG + Intronic
1009561318 6:65247927-65247949 TTGCTTATTTTGGAAAAAAATGG + Intronic
1010348244 6:74838679-74838701 TTACTTTGTCAGGAATAAAATGG - Intergenic
1010429376 6:75761453-75761475 TCACTTTCCTTCCAAAAAAAAGG - Intronic
1011008851 6:82681059-82681081 TTCCTTAGTGTGGAAAAAAAGGG + Intergenic
1011396842 6:86919196-86919218 TTATTTTACTTGTAAGAAAAAGG - Intergenic
1011646756 6:89466326-89466348 TTACTTTCCTTGAAGAGAAATGG + Intronic
1011671075 6:89683648-89683670 AGACTTTGCTTGGAGAAGAAGGG + Intronic
1011739632 6:90347101-90347123 TTCCTTTGATGGAAAAAAAAGGG + Intergenic
1011821618 6:91259781-91259803 TAACTTTACTAAGAAAAAAAAGG + Intergenic
1011833548 6:91403280-91403302 TTACATTGTTTGGAAAGGAAAGG - Intergenic
1011912203 6:92454509-92454531 TTACTTTTCTTGAAGGAAAAGGG + Intergenic
1011987658 6:93470153-93470175 TTACTTTGCTTGGCAAGACTGGG - Intergenic
1012046707 6:94284944-94284966 TTACTCAGTTTGGAAAAAGAAGG - Intergenic
1012794873 6:103747045-103747067 TTACTTTGGTTTCAAAAAACAGG + Intergenic
1013845087 6:114440553-114440575 TTAGTTTCTTTGGAAAAAGATGG - Intergenic
1014354611 6:120390307-120390329 TTGCTGTGGTAGGAAAAAAATGG - Intergenic
1015167030 6:130210053-130210075 TTGCATTACTTGGAAAATAAGGG - Intronic
1015213734 6:130725941-130725963 TTACTTTTCAAGAAAAAAAATGG - Intergenic
1015703971 6:136067296-136067318 TTATTTGGTTTGGAGAAAAATGG - Intronic
1016341221 6:143063087-143063109 TTACTGTGCATTGAAAAACAAGG + Intronic
1016724292 6:147343471-147343493 TTTCTTTTCTTGAAAAATAAAGG - Intronic
1017111654 6:150938470-150938492 TTTCTTTGCTTAAAAAAAAAAGG - Intronic
1017152057 6:151289567-151289589 TTACTCTACTGAGAAAAAAAGGG - Intronic
1017230055 6:152064077-152064099 TTACTTTGCTTGCAAAAACCCGG + Intronic
1017965026 6:159256686-159256708 TTGCTTTGGTTGGAAATGAAGGG + Intronic
1019941535 7:4295833-4295855 ACACTTTGGTTGGTAAAAAAGGG - Intergenic
1020520273 7:9176702-9176724 TGACTGTGGTTGGAAAAATATGG - Intergenic
1020828346 7:13060896-13060918 TTACTCTGATGGGAAAAAAAAGG + Intergenic
1021398919 7:20186654-20186676 TTAGTCTGTTTGAAAAAAAAAGG + Intronic
1022298637 7:29081569-29081591 TTACTTTGTCTAAAAAAAAATGG - Intronic
1022607135 7:31826494-31826516 TTAATTTGTCAGGAAAAAAAAGG - Intronic
1023332183 7:39130118-39130140 TTTCTTTACTTTAAAAAAAATGG - Intronic
1023481475 7:40639469-40639491 TTTATTTGCTTGTAAAAGAAAGG + Intronic
1023517543 7:41017134-41017156 TTGCTTTGCAAGAAAAAAAAAGG - Intergenic
1024440654 7:49413575-49413597 TGTCTTTTATTGGAAAAAAATGG - Intergenic
1024948029 7:54831591-54831613 CTACTCTGCTTGGGAATAAAAGG - Intergenic
1024987847 7:55211224-55211246 TTACTTATCTTTAAAAAAAAAGG + Exonic
1025247686 7:57329338-57329360 CTACTTTGCTTTGAAAATCAGGG - Intergenic
1026390217 7:69893686-69893708 TTAGTTTGCTTGGAAAAATCAGG + Intronic
1026513403 7:71046211-71046233 TTATTTTCCTGGGAAACAAATGG - Intergenic
1026520535 7:71113861-71113883 TTTTTTTTCTTGGAAAAAAGAGG - Intergenic
1028121272 7:87059203-87059225 TTCCTTTGCTTGGAGAACAGGGG - Intronic
1028546919 7:92012251-92012273 CTACTTTCCTTGAAAAAGAAAGG + Intronic
1028577924 7:92373001-92373023 TTACTATACTTGCAAAAGAATGG + Intronic
1029676310 7:102071511-102071533 ATTCTTTGCTTGGCAGAAAAAGG - Intronic
1030147330 7:106369926-106369948 TTTCTTTGTTTGTAAAATAAGGG + Intergenic
1030332934 7:108292341-108292363 TTTCTTTACTTGTGAAAAAACGG + Intronic
1030507322 7:110441531-110441553 TTATTTTGCCTAGATAAAAATGG + Intergenic
1030830720 7:114217389-114217411 TTATTTTACTAGGAACAAAATGG + Intronic
1030932623 7:115543634-115543656 TTACTTTGCTTTTTAAAAAATGG + Intergenic
1031663210 7:124453324-124453346 TTTCTTTCTTTGGAAAAACAGGG + Intergenic
1031702107 7:124939235-124939257 TTAATTTGTTTTGAAAATAATGG + Intergenic
1031709777 7:125031023-125031045 TTAATTTCCTTAGGAAAAAATGG + Intergenic
1031787595 7:126053759-126053781 TTGTTTTACTCGGAAAAAAATGG - Intergenic
1032579079 7:133087286-133087308 ATATTTTTTTTGGAAAAAAAAGG + Intergenic
1032594077 7:133221939-133221961 TTACTATGTTGGGAAGAAAATGG - Intergenic
1032823255 7:135544246-135544268 TTTGTTTTCTTGGGAAAAAAGGG + Intergenic
1032876059 7:136039348-136039370 TTACTTAGCTTTTAAAAACATGG - Intergenic
1033496717 7:141905878-141905900 TTACCTTGTATGGCAAAAAAGGG - Intergenic
1033614282 7:142997485-142997507 TTACATTGCATTGAAATAAAAGG + Intergenic
1033773439 7:144579967-144579989 TTCCTTTGATTGAAAACAAAAGG - Intronic
1034161961 7:149000615-149000637 TTACTTGGCTTGGGAAATAATGG - Intergenic
1035041280 7:155929505-155929527 TTATTTTGCAGGAAAAAAAAGGG - Intergenic
1036118029 8:5981254-5981276 TTACTTCTTGTGGAAAAAAATGG - Intergenic
1036609058 8:10334247-10334269 TTAATTTCCGTGGAAAAGAAAGG + Intronic
1039168996 8:34719789-34719811 TTACTTTTTTTTTAAAAAAAAGG + Intergenic
1039179511 8:34849582-34849604 TTACTTTGCTTTCAAATTAAGGG - Intergenic
1039200270 8:35083498-35083520 TTTCTATGCTTAGAAAAAGAGGG + Intergenic
1039256564 8:35725345-35725367 ATATTTGGCTTGGAAAAAAATGG + Intronic
1039493536 8:37965139-37965161 TGGCTTTGCTTGGAGAGAAAAGG - Intronic
1040895015 8:52357204-52357226 TTACATTGCTTGTAACACAAAGG - Intronic
1040922074 8:52632232-52632254 TCACTTTGCTTGGGAAAAATAGG - Intronic
1042539764 8:69896517-69896539 TTATTTTGCTTGGAATACATTGG - Intergenic
1042619450 8:70688729-70688751 TGAAATTGATTGGAAAAAAAAGG + Intronic
1042733214 8:71960223-71960245 TGACTCTGCTTGGAAGAAGAAGG + Intronic
1043448336 8:80341008-80341030 TTACTCTGCATGAAAAAAAATGG - Intergenic
1044238870 8:89865212-89865234 TTTCTTTGGGGGGAAAAAAAAGG - Intergenic
1044672236 8:94694142-94694164 TTTCTTCACTTGGAAAACAATGG - Intronic
1045035750 8:98175353-98175375 TTACTTGGCTTTAAAAAGAAAGG + Intergenic
1045182026 8:99794573-99794595 CTACTTTTCATGGAAAAGAATGG - Intronic
1045247666 8:100457868-100457890 TAGCTCTGCTTGGAGAAAAACGG - Intergenic
1045839973 8:106568238-106568260 CTACTTCATTTGGAAAAAAATGG + Intronic
1046083162 8:109397287-109397309 TTCCTTTGCTTCCAATAAAATGG + Intronic
1046651699 8:116842572-116842594 TTATTTTGCTTAGAAAACAAAGG - Intronic
1046834334 8:118782755-118782777 GTACTATGCCTGGAAAAGAATGG - Intergenic
1047133535 8:122050350-122050372 TTATTTTATTTGGGAAAAAATGG - Intergenic
1048510731 8:135059917-135059939 TTGCTTTGCTTTGGAAACAAGGG - Intergenic
1048517787 8:135126166-135126188 TTACTGTGCTTTCAAAATAATGG - Intergenic
1048518066 8:135128539-135128561 TTGGCTTGCTTGGAAAGAAAGGG + Intergenic
1048679982 8:136830720-136830742 TTTCTTTTCTTGAAAAGAAAAGG - Intergenic
1049133334 8:140869578-140869600 TTTTTTTGCTTAAAAAAAAAAGG - Intronic
1050085765 9:1964206-1964228 TTTCTTTGCTTGAGAAAAACAGG - Intergenic
1050542849 9:6684900-6684922 TTTGTTTGCTTACAAAAAAAGGG + Intergenic
1050719165 9:8565302-8565324 TTACTATTCTAGGGAAAAAAAGG - Intronic
1050866197 9:10503220-10503242 AAACTTTTCTGGGAAAAAAATGG - Intronic
1051283236 9:15465367-15465389 TTACTTTACTTTAAAACAAAGGG + Exonic
1051499635 9:17763121-17763143 TTACTTTATATGGAGAAAAATGG - Intronic
1051978534 9:22984381-22984403 TTACTTATTTTGGAAAACAAGGG + Intergenic
1052011857 9:23420267-23420289 TTACTGTGCTTGGAAGTACAAGG - Intergenic
1052544606 9:29859521-29859543 TTACTTTGCTTGAAAAAATGTGG - Intergenic
1052579959 9:30342408-30342430 ATACTATGCTTGCATAAAAAAGG + Intergenic
1053591029 9:39515004-39515026 TTACTTTGGTTGAAAAATGAGGG + Intergenic
1053809848 9:41840865-41840887 ATTCTTTGCTGAGAAAAAAATGG + Intergenic
1053848878 9:42270376-42270398 TTACTTTGGTTGAAAAATGAGGG + Intergenic
1054575276 9:66850286-66850308 TTACTTTGGTTGAAAAATGAGGG - Intergenic
1054620745 9:67346563-67346585 ATTCTTTGCTGAGAAAAAAATGG - Intergenic
1054702777 9:68430652-68430674 TTTTTATGCTTGGAAAAAAATGG - Intronic
1055107541 9:72528139-72528161 TTACTGTTCTTATAAAAAAAAGG + Intronic
1056267887 9:84917662-84917684 TTACTCTGCTTGGACAAAGTAGG - Intronic
1056691128 9:88809507-88809529 TTATTATTCTTGGAAAAATAAGG + Intergenic
1056749733 9:89339382-89339404 TTAGGTTCCTTGGAAAAAGATGG - Intronic
1057038027 9:91825736-91825758 TTATTTTGCTGGAAAAAAAGTGG + Intronic
1057874175 9:98740869-98740891 TTAATTTGATAGGCAAAAAAAGG - Intronic
1058055989 9:100449347-100449369 TTACTTTGTTTGGTACACAATGG - Intronic
1058170394 9:101673699-101673721 TTACTCTTCTTGGATAAACAAGG + Intronic
1059536175 9:115083140-115083162 TTTCTTCACTTGGAAAAAGAAGG + Intronic
1059734046 9:117084225-117084247 TTACTGTGCTTGCAAGTAAAGGG + Intronic
1060284857 9:122241142-122241164 TTATTTAGATTTGAAAAAAATGG + Exonic
1060896705 9:127223578-127223600 ATACCTCGCTTGGAGAAAAAGGG + Intergenic
1062417427 9:136459256-136459278 TTATTTTGATTTGGAAAAAATGG + Intronic
1186071159 X:5822302-5822324 TCAATCTGCTTGAAAAAAAAAGG - Intergenic
1186353697 X:8767850-8767872 GTACTTTGCTTGGAAAAAAATGG + Intergenic
1186356053 X:8791606-8791628 GTACTTTGCTTGAATAAAATGGG + Intronic
1186576875 X:10776096-10776118 TGATTTTGCTTTGAACAAAATGG - Intronic
1186751652 X:12627853-12627875 TTACTTTATTAAGAAAAAAATGG + Intronic
1186917763 X:14242144-14242166 ACACCTTGGTTGGAAAAAAAGGG - Intergenic
1188542237 X:31263694-31263716 TTGCATTGCTTAGAAATAAAAGG - Intronic
1189572425 X:42312411-42312433 TTAATTTTCTCTGAAAAAAATGG - Intergenic
1189793774 X:44628044-44628066 AAACTTAGCTGGGAAAAAAAAGG - Intergenic
1191006592 X:55716699-55716721 TTACTTTGATAAGAAAAAAAGGG - Intergenic
1191145025 X:57156690-57156712 AGACTTTGCTTGGAAAACCAGGG - Intergenic
1191657334 X:63612720-63612742 GGACTTTGCTGGGAAGAAAAGGG + Intergenic
1192845826 X:74906365-74906387 TTCATTTCCTTGGAACAAAAAGG - Intronic
1193600534 X:83504515-83504537 TTTCCTTGCTTAGAAAGAAAGGG + Intergenic
1193784039 X:85736840-85736862 TTGCTTTGTTTGGATCAAAAGGG + Intergenic
1194204940 X:91001834-91001856 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1194594560 X:95841178-95841200 TTATTTTGTGAGGAAAAAAATGG - Intergenic
1195735190 X:108005324-108005346 TTAATTTGTAAGGAAAAAAAAGG - Intergenic
1195780664 X:108460240-108460262 TTACTTTGTTTCAAAATAAAAGG + Intronic
1195901078 X:109797915-109797937 TTTATTTAATTGGAAAAAAAGGG - Intergenic
1196043473 X:111231230-111231252 TTACTTTGCTGGCAAACATATGG + Intergenic
1196356440 X:114799486-114799508 TTACTTTAATTACAAAAAAAAGG + Intronic
1199965483 X:152817181-152817203 TTCTTTTGTCTGGAAAAAAAAGG + Intergenic
1200020964 X:153207465-153207487 GTACTTTGCCTGAAAAAAATGGG - Intergenic
1200550766 Y:4576977-4576999 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1200769912 Y:7114329-7114351 GTACTTTGCTTGGATAAAATGGG - Intergenic
1200906310 Y:8486239-8486261 TAACTTTACTTGGAAATAACTGG + Intergenic
1201180619 Y:11340611-11340633 TTATTTTGCTTGGATCATAATGG + Intergenic
1201372859 Y:13283964-13283986 AAAGTTTGCTTTGAAAAAAAGGG + Intronic
1201411642 Y:13704417-13704439 TTACTTTCTTTGGAAGACAATGG - Exonic
1201580734 Y:15509900-15509922 ATACTTTACCAGGAAAAAAAAGG - Intergenic