ID: 986573596

View in Genome Browser
Species Human (GRCh38)
Location 5:9190348-9190370
Sequence CACAGTGCCCTCCTTCATGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986573596 Original CRISPR CACAGTGCCCTCCTTCATGG AGG (reversed) Exonic
900226993 1:1537539-1537561 CACCTGGCCCTCCTTCCTGGAGG + Intronic
900981766 1:6049867-6049889 CACAGCTGCCTCTTTCATGGGGG - Intronic
901020689 1:6253846-6253868 CACCGTGCCCACCATCGTGGTGG - Exonic
901221886 1:7588049-7588071 CCCAGTGCCCACCTGCACGGTGG - Intronic
902442970 1:16443178-16443200 CACAGTGTCCTCCTCCACGTAGG - Intronic
902808721 1:18876306-18876328 CCCAGTCACCTCCTTCATGATGG + Exonic
902879963 1:19365481-19365503 ACCAGAGCCCTCCTTCCTGGTGG - Intronic
903735621 1:25528433-25528455 CCCAGTGCCCTCCTTGCTGCTGG + Intergenic
904592713 1:31623984-31624006 CAAAGTCCCTGCCTTCATGGAGG + Intronic
906541831 1:46592755-46592777 CACTGTCCCTTCCTTCAAGGAGG - Intronic
908492044 1:64654845-64654867 TACAGTGCTCTTCTTCATGTTGG + Intronic
909428300 1:75553932-75553954 GACAGTGCCCTGCTTCAGGCTGG - Intronic
911274772 1:95848244-95848266 CACAGTCCCTTCCTACATTGCGG + Intergenic
912069076 1:105785317-105785339 CACAGTGCGTTCCTTTCTGGAGG - Intergenic
913606284 1:120469355-120469377 CAGATTGCCCTCCTTAATAGGGG - Intergenic
913988979 1:143592051-143592073 CAGATTGCCCTCCTTAATGGGGG + Intergenic
914210151 1:145570794-145570816 CAGATTGCCCTCCTTAATAGGGG + Intergenic
914269069 1:146063160-146063182 CAGATTGCCCTCCTTAATAGGGG + Intergenic
914368027 1:146997706-146997728 CAGATTGCCCTCCTTAATAGGGG - Intergenic
914411418 1:147431949-147431971 CACAGTGCCCTACTTTTAGGCGG + Intergenic
914484953 1:148100500-148100522 CAGATTGCCCTCCTTAATAGGGG + Intergenic
914584915 1:149052487-149052509 CAGATTGCCCTCCTTAATAGGGG + Intergenic
915266538 1:154722313-154722335 CACAGTCAACTCCTTCATGTTGG + Intronic
917716862 1:177747231-177747253 CAGATTGCCCTCCTTAATGTTGG + Intergenic
918564295 1:185909440-185909462 CACAGTGACCTCTTTCAGGCTGG - Exonic
920684786 1:208101282-208101304 CACGGTGGCCTCTTTAATGGAGG - Intronic
922534626 1:226370684-226370706 CACACTGCCATCCCTCATGGTGG - Intronic
923380591 1:233413972-233413994 CACATTGCCCTCCCTAATGTGGG + Intergenic
1062938249 10:1403626-1403648 CACGGTGCCCTCCCTCAGAGTGG - Intronic
1062979804 10:1712646-1712668 CCCAGTGCCCTCCTTCCCTGGGG - Intronic
1063036424 10:2290673-2290695 CACAGTGCTCTCCTGCATGAAGG - Intergenic
1063036456 10:2290810-2290832 CACAGTGCTCTCCTGCATGAAGG - Intergenic
1063036490 10:2290947-2290969 CACAGTGCTCTCCTGCATGAAGG - Intergenic
1063036523 10:2291085-2291107 CACAGTGCTCTCCTGCATGAAGG - Intergenic
1063983837 10:11479861-11479883 CACTGTGCCCAGCCTCATGGAGG + Intronic
1064104158 10:12487176-12487198 CACCGGGGCCTCCTTCAGGGTGG - Intronic
1064849751 10:19697397-19697419 CACATGGCCCTCCATAATGGGGG - Intronic
1065309204 10:24397854-24397876 CTCAGTGCCCTCTTTATTGGGGG - Intronic
1066046147 10:31597201-31597223 CAGAGTGCCCTCCCTAATGTGGG - Intergenic
1066997202 10:42575294-42575316 CACAGGGCCATCCTCCAGGGTGG + Intronic
1069595639 10:69668274-69668296 CAAATTGCCCTCCCTAATGGGGG - Intergenic
1069886427 10:71626786-71626808 CCCAGTTACCACCTTCATGGAGG - Intronic
1069915004 10:71782003-71782025 CACAGTGCACCACTGCATGGAGG + Intronic
1073069734 10:100785748-100785770 CCCTGTGCCTTCCTTCCTGGTGG - Intronic
1073223679 10:101897747-101897769 CACAGTGCCATCCCTCACTGTGG - Intronic
1074597998 10:114885064-114885086 CATACTGCCCACCTTCCTGGGGG + Intronic
1075394264 10:122115238-122115260 CACAGCCCCCACCTTCAAGGAGG + Intronic
1075486650 10:122827958-122827980 AAAACTGCCCTCCTCCATGGGGG - Intergenic
1075742032 10:124701791-124701813 CACAGGGCCCACCTGCCTGGGGG - Intronic
1076186944 10:128457550-128457572 CCCATTGCCCACCTCCATGGGGG - Intergenic
1076670289 10:132117299-132117321 CTCAGTGCCCTGCGTGATGGCGG + Exonic
1077236934 11:1486363-1486385 CACCCTGACCTCCTTCCTGGGGG + Intronic
1077439996 11:2563668-2563690 CTCGGTGCCATCCTTCACGGGGG - Intronic
1080149076 11:29026475-29026497 CAAACTGCCCTCCTTCTTAGGGG + Intergenic
1081327890 11:41768753-41768775 CACATTGTACTCCTTAATGGAGG - Intergenic
1081566330 11:44263400-44263422 CACAGAGCCCCGCTTCCTGGAGG + Exonic
1081709704 11:45208955-45208977 CAAAGAGCACTGCTTCATGGTGG - Intronic
1082873563 11:57965979-57966001 CACTGGGGCCTCCTTGATGGTGG - Intergenic
1084942135 11:72618499-72618521 CACAGAGCCCTCCTCCAGTGAGG + Intronic
1085731845 11:79006934-79006956 CAGATTGCCCTCCTTCATGTAGG + Intronic
1087102639 11:94380271-94380293 CCCAGTTCCTTCCTTCAGGGTGG - Exonic
1088169100 11:106975505-106975527 GACAGTGCCCTCCCTGCTGGAGG - Intronic
1088894452 11:114067263-114067285 CACAGTGCCACCCTCCATGAGGG + Intronic
1090735848 11:129611635-129611657 TACATTGCCCTCTTTCATAGGGG - Intergenic
1091693812 12:2614617-2614639 CACAGAGTCCTACTTAATGGTGG - Intronic
1091986322 12:4912029-4912051 CACAGACCCCTTCTTCATCGTGG + Exonic
1092023295 12:5220636-5220658 CACTGAGCCTACCTTCATGGTGG + Intergenic
1092923422 12:13252542-13252564 CAAATTGCCCTCCTTAATGTGGG - Intergenic
1093416733 12:18928897-18928919 CACAGTGTCCTTCCTCAGGGGGG - Intergenic
1094496674 12:30993229-30993251 CAAGGTGCCCCCCTTCATGGGGG - Exonic
1094714891 12:33003142-33003164 CACCGTGCCCGGCTTCATTGTGG + Intergenic
1097451494 12:59742110-59742132 CACAGTGCCCTCCTTGCTCTTGG + Intronic
1104765724 12:131328629-131328651 CGCAGTGCATTCATTCATGGAGG + Intergenic
1104813541 12:131633231-131633253 CGCAGTGCATTCATTCATGGAGG - Intergenic
1104870398 12:131991150-131991172 CACAATGCCCACCCTCCTGGGGG - Intronic
1107479358 13:40772384-40772406 CACAGTTCCCTGTTTCATGAGGG - Intergenic
1107993444 13:45838558-45838580 CACAGTGCCCCCCAGCGTGGTGG - Intronic
1108530854 13:51325693-51325715 CAGATTGCCCTCCTGCATGTGGG + Intergenic
1110119683 13:71866160-71866182 CAAAGTGGCTTCCTTCACGGTGG - Exonic
1111113179 13:83742384-83742406 CACACTGTCTTCCCTCATGGTGG - Intergenic
1112011022 13:95293930-95293952 CACCCTGCCTTCTTTCATGGTGG - Intronic
1112187744 13:97144271-97144293 CTCAGACCCCTCCTTCATGGAGG - Intergenic
1113301075 13:109019832-109019854 CCCATTCCCATCCTTCATGGGGG - Exonic
1113684747 13:112275210-112275232 CAGACTGCCCTCCCTAATGGGGG + Intergenic
1113887108 13:113666751-113666773 CACAGTGACCAGCTTCCTGGGGG - Intergenic
1116761231 14:49017658-49017680 CACAGAGCCCACATTCATGCTGG + Intergenic
1117760532 14:59022558-59022580 CACAGTGTCCTTCTTCATTCTGG - Intergenic
1118992646 14:70809744-70809766 CACCGTGCCCTCCCCCATTGCGG + Intergenic
1119132527 14:72187590-72187612 CAGGGTGTCCTCCTTCATGCTGG - Intronic
1119529886 14:75352636-75352658 CTCCGTGGCCTCCTTCAGGGAGG + Intergenic
1121307417 14:92915782-92915804 CACAGTGCACTCCCTAATGGTGG - Intergenic
1122108401 14:99478768-99478790 CACAGTACTCTCCTGCCTGGAGG - Intronic
1122562718 14:102628204-102628226 CAGACTGCCCTCCTTAATGTGGG - Intronic
1122632008 14:103111524-103111546 GGCAGTGCCCTCCTCCATGGGGG + Intergenic
1124350345 15:28950730-28950752 TACACTCCACTCCTTCATGGGGG + Intronic
1124376961 15:29134515-29134537 CACAGGGACCTCCTTCAGGGTGG - Intronic
1127582737 15:60352371-60352393 CACAGTGCCCACCTTTCTGGAGG + Exonic
1128880520 15:71238035-71238057 CATAGAGCCCTACTTTATGGTGG + Intronic
1129310374 15:74704088-74704110 CACAGTGCCTGGCTTCATTGTGG - Intergenic
1129451483 15:75653571-75653593 CACTGTGCCCTCCCAGATGGGGG + Intronic
1129653373 15:77507010-77507032 CACAGGGCCCTCCTTCATGTGGG + Intergenic
1130220505 15:82015384-82015406 ATCAGTGCCCTCCTTCAGGCTGG + Intergenic
1131358149 15:91764272-91764294 CAGATGGCCCTCCTTCATGAGGG - Intergenic
1131518918 15:93098904-93098926 CAAAGTGTCCCCCTTCATGTAGG - Intergenic
1131679153 15:94703198-94703220 CACAGTGACAGACTTCATGGAGG + Intergenic
1133390933 16:5409322-5409344 CTCACTGACCTCCTTCAAGGTGG + Intergenic
1139048673 16:63096230-63096252 CACAGTGCCCACCCACATTGAGG - Intergenic
1139088408 16:63616591-63616613 CACAGTGGCCAGCTCCATGGAGG + Intergenic
1139545491 16:67647839-67647861 CCCAGAGCCCTCATTCCTGGTGG - Exonic
1141173543 16:81705229-81705251 TTCAAAGCCCTCCTTCATGGAGG + Intronic
1141346053 16:83247082-83247104 CACAGTGCCCTCCTGTTTAGAGG - Intronic
1143859143 17:9875280-9875302 CACAGTGCCCTCTTCCATGTCGG + Intronic
1144861104 17:18302762-18302784 CACACTGCCCTCCATCATAAAGG + Intronic
1145016887 17:19404873-19404895 CACAGTGCCAGGCTTCATGAAGG + Intergenic
1146600362 17:34209326-34209348 AATAGTGCCCACCTACATGGAGG + Intergenic
1146919842 17:36703211-36703233 CACAGTGCCTTCCACCAGGGAGG + Intergenic
1148450938 17:47777536-47777558 CACAGAGCCCAGCTTCAGGGAGG - Intergenic
1148676856 17:49450825-49450847 CACAGAGCCTGCCTTCCTGGGGG - Intronic
1152700861 17:81818367-81818389 AACAGTGACCTCTTTCAGGGGGG - Intergenic
1153941361 18:9981262-9981284 CATAGTCCCCTACTTCTTGGAGG + Intergenic
1154411398 18:14144019-14144041 CACATTGCCCTGTATCATGGGGG - Intergenic
1157044851 18:44089141-44089163 CAGAGTGCTCTCCTTAATGGGGG - Intergenic
1157055803 18:44227176-44227198 CACAGTGACTTCCCTGATGGTGG - Intergenic
1157153312 18:45240944-45240966 CACCGCGCCCAGCTTCATGGAGG + Intronic
1158917652 18:62151528-62151550 CACAGTGCCCTCCTTAACCTTGG - Intronic
1159043956 18:63351002-63351024 CACCCGGCGCTCCTTCATGGTGG + Exonic
1160509806 18:79447085-79447107 CACTGTGGCCTCCTCCCTGGCGG + Intronic
1160958845 19:1708249-1708271 CACAGGGCCCTCCTGGAAGGAGG - Intergenic
1161457602 19:4377319-4377341 CTCAGTGCCCTCCTCCCTGCTGG - Intronic
1162550346 19:11355162-11355184 CACAGAGCCTTCCTTTCTGGGGG + Intergenic
1162965272 19:14152550-14152572 GACGGAGTCCTCCTTCATGGCGG - Exonic
1164546895 19:29173579-29173601 GACAGTGCTTTCCTACATGGAGG - Intergenic
1165141617 19:33703276-33703298 CACCGGGCCCTTCTTCATGCTGG - Intronic
1165720418 19:38075020-38075042 CACTGTGCCCGGCTTCATTGAGG + Intronic
1166046133 19:40232210-40232232 CTCAGTGCCCTCCTTGCTGAAGG + Exonic
1167036684 19:46999073-46999095 CACAGTGCCGCCCTTCAGCGGGG + Intronic
926353266 2:12016357-12016379 CAGATTGCCCTCCTTAATGTGGG - Intergenic
928173289 2:29017290-29017312 CCCAGTACCTTCCTTCATGAAGG - Exonic
929813527 2:45212506-45212528 GTCAGAGCCCACCTTCATGGAGG + Intergenic
930718497 2:54615796-54615818 CACAGTGCCCTCATCAATGAAGG + Intronic
932296547 2:70628405-70628427 CACTGTGGCCTCCTTGAGGGTGG - Intronic
932647540 2:73519443-73519465 CACAGTCCCCTAATTTATGGTGG + Intronic
933594016 2:84263827-84263849 CACAGTTCCCTATTTCTTGGAGG - Intergenic
933636836 2:84717552-84717574 CACAGTGCCCACCTTATGGGGGG + Intronic
934515403 2:94982959-94982981 CACTGTGCCCTGACTCATGGAGG - Intergenic
935140774 2:100350990-100351012 CACAGTTACCACCTACATGGAGG + Intergenic
936518284 2:113196240-113196262 CACAGTGCCCACCTACAAGCAGG + Exonic
937496920 2:122429933-122429955 GTAAGTGCCCTCATTCATGGAGG - Intergenic
938441647 2:131340090-131340112 CACATGGCCCTCCTTCAATGGGG - Intronic
939025906 2:137013726-137013748 CACTCTGCCCTGCTTCAAGGAGG + Intronic
939126699 2:138186189-138186211 CAGATGGCCCTCCTTCATGTGGG - Intergenic
939976524 2:148723008-148723030 CACTGGGACCTCCTTCAGGGTGG + Intronic
940036041 2:149312918-149312940 GAAAGTGTCCTCCTTCTTGGTGG + Intergenic
943366706 2:186973462-186973484 GGCAGTGCCCTCCCTCTTGGGGG + Intergenic
947560797 2:231149375-231149397 CACTGTGCCCATCTTAATGGTGG - Intronic
948658211 2:239489958-239489980 CTCAGTGCCCAGCTTCCTGGGGG + Intergenic
1169189163 20:3646366-3646388 CACAGTGCTCTGCTTGGTGGTGG - Intronic
1170500848 20:16974475-16974497 CCCAGAGCCCGCCGTCATGGTGG + Intergenic
1171086396 20:22241841-22241863 CACAGTGCCCTGCCATATGGAGG - Intergenic
1173025145 20:39300551-39300573 CAGGGTGCCCTCCTCCTTGGAGG + Intergenic
1175922844 20:62458167-62458189 CACAGAGCCGTCCTGCCTGGAGG - Intergenic
1176099529 20:63358674-63358696 CAACCTGCCCTCCTCCATGGTGG + Intronic
1176861658 21:14014398-14014420 CACATTGCCCTGTATCATGGGGG + Intergenic
1178376970 21:32074978-32075000 CACTGTGCCCTGCCTCAAGGAGG + Intergenic
1178400629 21:32282062-32282084 GAGATTGCCCTCCTTCCTGGGGG + Intergenic
1180060982 21:45384984-45385006 CACTTTCCCCTCCTTTATGGAGG - Intergenic
1180249362 21:46570744-46570766 CACAGTGCTGGCCTTCATGTTGG + Intergenic
1181572981 22:23777893-23777915 CAGAAGGCCCCCCTTCATGGTGG + Intronic
1182285771 22:29245972-29245994 CACAGTCCCCACCCTCAGGGTGG + Intronic
1182719447 22:32385596-32385618 CACCGTGCCAGACTTCATGGAGG + Intergenic
1184806007 22:46795331-46795353 GACAGTGCCCTGCATCTTGGGGG - Intronic
1185148740 22:49152642-49152664 CACAGAGCCCTCCTCCCTGCGGG - Intergenic
949098306 3:112939-112961 CAGATTGCCCTCCATAATGGAGG + Intergenic
950089853 3:10287874-10287896 CACTGGGTCCACCTTCATGGTGG - Intronic
950557449 3:13704100-13704122 CACATGGCCCTCCCTAATGGTGG - Intergenic
950708772 3:14800602-14800624 CACAGGGCCCTCCTCAATGTGGG - Intergenic
953998831 3:47540626-47540648 CACAGTGACCTCCCTCCTGCAGG + Intergenic
954425571 3:50441130-50441152 CACATGTCCCTCCTTCCTGGAGG - Intronic
954786679 3:53098512-53098534 CACCGTGCCCAGCCTCATGGGGG - Intronic
955223317 3:57040889-57040911 CACAGTGCCCTCCTCTGTGAAGG + Intronic
955518684 3:59753083-59753105 CATAATCCCCTCCTTCAAGGTGG + Intronic
955703770 3:61707601-61707623 CACATTGCCCTCCCTAATGTGGG - Intronic
957291971 3:78289299-78289321 CAGATTGCCCTCCTTGATGTGGG + Intergenic
958849061 3:99301977-99301999 CACAGTGCCATATTTCTTGGAGG - Intergenic
962496818 3:135948221-135948243 TACGGTCCCCTCCTTCAGGGAGG + Intergenic
964578955 3:158209049-158209071 CACAGTGCCATCCTTAAAAGGGG + Intronic
966207497 3:177419991-177420013 CAGGGTCCCTTCCTTCATGGAGG - Intergenic
966341797 3:178933315-178933337 CACAGGGGCCTACTTGATGGGGG + Intergenic
966496665 3:180589566-180589588 CACATTGCCCTCCATCATCTGGG + Intergenic
975194618 4:71509541-71509563 CTTAGTGGCCTACTTCATGGGGG + Intronic
976006951 4:80441034-80441056 CACAGTCCCATATTTCATGGAGG - Intronic
976918277 4:90405342-90405364 CACAGTGCCAAACTTCTTGGAGG - Intronic
982186440 4:152806358-152806380 CACAGTGCCCACCTACAAAGAGG - Intronic
984926529 4:184811998-184812020 CTCAGGGCCCTCCTTCATGTGGG + Intronic
985491033 5:179594-179616 CAGAGAGCTCTCATTCATGGCGG - Intronic
986236108 5:5912248-5912270 CACACTCCCCTCCTCCCTGGGGG - Intergenic
986573596 5:9190348-9190370 CACAGTGCCCTCCTTCATGGAGG - Exonic
987103552 5:14614746-14614768 CACACAGCCCTCCTCCATGCTGG - Intronic
987167705 5:15218692-15218714 GACAGCCCCTTCCTTCATGGTGG + Intergenic
987552695 5:19404528-19404550 CACAGTCACCTCATTCATGGAGG - Intergenic
988327292 5:29786638-29786660 CACACTGCCCTCGCTAATGGGGG - Intergenic
988327684 5:29791160-29791182 CACACTGCCCTCGCTAATGGGGG + Intergenic
991663144 5:68970320-68970342 CCCAGTGACTACCTTCATGGGGG + Intergenic
992284138 5:75215251-75215273 CAGACTGCCCTCCATCATGTGGG - Intronic
993587177 5:89745877-89745899 CACAGTCCCATACTTCTTGGAGG + Intergenic
996200765 5:120669321-120669343 CATAGTTCCCTGCTTGATGGTGG + Intronic
997690598 5:135825382-135825404 CACAGTGCCCAGCTGCATGGTGG - Intergenic
998474243 5:142407402-142407424 AACAGTCCCCACCCTCATGGAGG + Intergenic
999319926 5:150608019-150608041 CACTGTGCCGTCCAACATGGCGG - Intronic
1000791956 5:165618954-165618976 CACAGTGCTTTCCTTCTGGGGGG + Intergenic
1000988394 5:167886078-167886100 CACAGTGTGCTCCTGCCTGGTGG + Intronic
1002571675 5:180143183-180143205 CAGAGTGCCCCCCTGCAGGGTGG - Intronic
1002794852 6:464020-464042 CAGATTTCCCTCCTTCATGGGGG + Intergenic
1003995081 6:11532165-11532187 CAGACTGCCCTCCCTCATGTGGG + Intergenic
1007679499 6:43624667-43624689 GAAAGTGCCCTTCTTCATCGTGG - Exonic
1011331240 6:86208995-86209017 CAGATTGCCCTCCTTAATGTGGG - Intergenic
1012028929 6:94033297-94033319 CACTGTTCCTTCTTTCATGGTGG - Intergenic
1012244737 6:96913809-96913831 CACTGTCCCCTCCGTCATGGGGG + Intergenic
1016846121 6:148570364-148570386 CACAGTGCTCGGCTTCAGGGTGG - Intergenic
1016847327 6:148581328-148581350 CACAGTGCCCTCCTTACCGTTGG + Intergenic
1017186069 6:151601803-151601825 CAGAGTGCCCTCCATAATGTGGG - Intronic
1017431250 6:154373369-154373391 CACTGTGCCCGGCCTCATGGTGG - Intronic
1020101786 7:5397869-5397891 GACAGTTCCCTCCTTGAGGGCGG + Intronic
1020129846 7:5553544-5553566 CACAGTGCATTCCTTCCTTGGGG + Intronic
1021635378 7:22687267-22687289 CACAGTGCCCTTCTAGAAGGTGG - Intergenic
1022039536 7:26567095-26567117 CACAGAGCCCACCTTTACGGGGG + Intergenic
1022632348 7:32097156-32097178 CAGATTGCCCTCCCTCATGCAGG - Intronic
1024241477 7:47439619-47439641 CCCATGGCCCTCCTCCATGGTGG + Exonic
1024775345 7:52778590-52778612 AACTGTTCCCTCCTTCATGCAGG - Intergenic
1028360758 7:89963887-89963909 CAAATTGCCCTCCTTAATGTGGG - Intergenic
1028860695 7:95646851-95646873 CACTGGGCCCTCCTTGAGGGTGG - Intergenic
1030604432 7:111624396-111624418 GACTATGCCCTACTTCATGGAGG - Intergenic
1031774286 7:125887268-125887290 AACACTGCCCTACATCATGGTGG + Intergenic
1036000657 8:4599969-4599991 CACAGTGAACACCTCCATGGAGG - Intronic
1037919575 8:22796067-22796089 CACAGTGTCCTCCAATATGGCGG + Intronic
1038591135 8:28839023-28839045 CACAGGGCCCTCCACCGTGGAGG + Intronic
1038817311 8:30918127-30918149 CACCGTGTGCTCATTCATGGAGG - Intergenic
1040095167 8:43435710-43435732 CACAGTGACCTCCATCACTGGGG - Intergenic
1040817086 8:51520069-51520091 CTCAGTGAACTCCTTCCTGGAGG - Intronic
1040887688 8:52283259-52283281 GACAGTCACCTCCATCATGGCGG - Intronic
1045201396 8:99985558-99985580 CACACTGCCCTCTTTCAGGCAGG - Intronic
1045398147 8:101782836-101782858 CACAGTGCCCAGCATCATGCAGG - Intronic
1047803214 8:128331329-128331351 CACAGTGCCCTGCTACACAGTGG - Intergenic
1049670521 8:143867526-143867548 CACGGTGCCCTCCACCAGGGAGG - Exonic
1050501637 9:6304448-6304470 CAAATTGCCCTCCATAATGGGGG - Intergenic
1051451533 9:17203494-17203516 CATAGTGCCCTAATTCTTGGAGG + Intronic
1052599878 9:30613091-30613113 CACAGTTCTCTTCTGCATGGAGG - Intergenic
1055425293 9:76189122-76189144 CACAGAGGGCTACTTCATGGAGG + Exonic
1056600982 9:88046786-88046808 CAGAATTCCCTCCTCCATGGGGG + Intergenic
1058085900 9:100748130-100748152 CACAGTTCCATACTTCTTGGAGG + Intergenic
1058150132 9:101454528-101454550 CACAGGGCACTCCTGGATGGTGG - Intergenic
1060470014 9:123940755-123940777 CCCAGCTCCTTCCTTCATGGAGG - Intergenic
1062053813 9:134460480-134460502 CATCGGGCCCTCCTTCCTGGAGG + Intergenic
1186182372 X:6985749-6985771 CTCAGTGCCCACCTTCCTGGAGG + Intergenic
1187250628 X:17594863-17594885 GCCAGTGCCCTACTTCAAGGTGG - Intronic
1187946143 X:24427924-24427946 CTCTGTGCCCCCCTTCCTGGAGG - Intergenic
1187990741 X:24869478-24869500 CACTGTGCCCTCCTTGCAGGAGG - Intronic
1188335029 X:28921028-28921050 CAAAGTGCCCTACTTGAGGGTGG + Intronic
1188336411 X:28939516-28939538 CACAGGGGCCTACTTCAGGGTGG + Intronic
1188472070 X:30552206-30552228 CACATTGCCCTCCCTAATGTGGG - Intergenic
1189497858 X:41525572-41525594 CACAGTCCCTCCCTTCAAGGAGG - Intronic
1189918943 X:45884620-45884642 CACATTGCCCTCCCTAATGTGGG + Intergenic
1190225961 X:48545092-48545114 CACAGTACACTCCCTCATGGTGG + Intronic
1195345703 X:103949066-103949088 AAAAGAGCCCTCCTTCCTGGAGG + Intronic
1197160271 X:123314963-123314985 AACTGTGACCTCCTTCATGAAGG - Intronic
1199057702 X:143318047-143318069 CACAGTGCCAGACTTCCTGGAGG + Intergenic
1202256047 Y:22921266-22921288 CATAGTCCCATCCTTCTTGGAGG - Intergenic
1202409038 Y:24555019-24555041 CATAGTCCCATCCTTCTTGGAGG - Intergenic
1202461745 Y:25115059-25115081 CATAGTCCCATCCTTCTTGGAGG + Intergenic