ID: 986582313

View in Genome Browser
Species Human (GRCh38)
Location 5:9278698-9278720
Sequence CTTTAGCCATAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 12, 3: 43, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986582313_986582323 12 Left 986582313 5:9278698-9278720 CCCAGCTCCAGCTATGGCTAAAG 0: 1
1: 1
2: 12
3: 43
4: 242
Right 986582323 5:9278733-9278755 AGCTCAGGCTGAGGCTTCAGAGG 0: 1
1: 218
2: 500
3: 894
4: 1606
986582313_986582324 13 Left 986582313 5:9278698-9278720 CCCAGCTCCAGCTATGGCTAAAG 0: 1
1: 1
2: 12
3: 43
4: 242
Right 986582324 5:9278734-9278756 GCTCAGGCTGAGGCTTCAGAGGG 0: 1
1: 211
2: 486
3: 875
4: 1569
986582313_986582320 -3 Left 986582313 5:9278698-9278720 CCCAGCTCCAGCTATGGCTAAAG 0: 1
1: 1
2: 12
3: 43
4: 242
Right 986582320 5:9278718-9278740 AAGGGGCCAAGGTACAGCTCAGG 0: 306
1: 827
2: 1320
3: 1370
4: 1281
986582313_986582322 3 Left 986582313 5:9278698-9278720 CCCAGCTCCAGCTATGGCTAAAG 0: 1
1: 1
2: 12
3: 43
4: 242
Right 986582322 5:9278724-9278746 CCAAGGTACAGCTCAGGCTGAGG 0: 42
1: 162
2: 346
3: 591
4: 855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986582313 Original CRISPR CTTTAGCCATAGCTGGAGCT GGG (reversed) Intronic
901715256 1:11148550-11148572 CTTTAGGCATAGCTGGATGCAGG + Intronic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
907765250 1:57403410-57403432 CTCTAGCCATAGCTGCAACTAGG + Intronic
911205186 1:95085529-95085551 CCTTAGCCACAGCTGGAGTTTGG - Intergenic
911793923 1:102053507-102053529 CCTTGGCCAGAGCTGGAGCTGGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916970908 1:170014402-170014424 CCTAAGGCATAGCTAGAGCTAGG - Intronic
917067908 1:171117089-171117111 CTTTTGCCAAACCTGGAGATGGG - Exonic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919965115 1:202515447-202515469 CTTTAGGCATAGCTAAATCTAGG + Intronic
923205151 1:231752145-231752167 CTTTAGCCATACCTGCAATTTGG + Intronic
1062957781 10:1551751-1551773 ATTTGGCCATCGCTGGACCTGGG - Intronic
1063718348 10:8553071-8553093 CTTTTGCCATGACTGAAGCTGGG - Intergenic
1068160216 10:53253563-53253585 CTTTAGCCATGGCTGGTGTTAGG - Intergenic
1069805010 10:71116736-71116758 TTTGAGCTATGGCTGGAGCTGGG - Intergenic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1071977529 10:90969861-90969883 CTTCAGCCATGGCTGGATCTGGG - Intergenic
1072296037 10:94010243-94010265 TTTGAGCCACAGCTGGAACTGGG + Intronic
1073474696 10:103745258-103745280 TTTCAGGCATAGCTGGATCTAGG - Intronic
1074043940 10:109819731-109819753 CTATAGGCAGAGCTGGAACTAGG + Intergenic
1074047981 10:109856694-109856716 CCTGAGCAATAGCTGGGGCTGGG + Intergenic
1074259436 10:111836970-111836992 CTTTAGAGATAGCTGGATGTAGG - Intergenic
1074539777 10:114354807-114354829 CTTCAGGCATGGCTGGACCTAGG - Intronic
1075341910 10:121653731-121653753 AGTGAGCCATAGCAGGAGCTGGG + Intergenic
1077877537 11:6320555-6320577 CCTGAGTCACAGCTGGAGCTGGG - Exonic
1082801430 11:57417742-57417764 CCTTACCCATAGCTGTAGTTGGG + Exonic
1083211993 11:61193938-61193960 CTTCAGCCCCAGCTCGAGCTGGG + Intergenic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1085965032 11:81513165-81513187 TTTTAGCCACAGCTGAAGCAGGG - Intergenic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1087882801 11:103438535-103438557 CTTAAACTATAGCTGGATCTGGG - Intronic
1088408610 11:109508538-109508560 CTTCAGCCATGGCTGGATCTAGG - Intergenic
1089500810 11:118930154-118930176 CCTTAGTCCTCGCTGGAGCTAGG - Intronic
1089737723 11:120561553-120561575 CTTTTGCCATTGCTGGAGCGGGG - Intronic
1090766222 11:129878488-129878510 CTCTAGCCATAGCTGGAAGAGGG + Exonic
1091678646 12:2510379-2510401 CTTTAGTCAGATCTGGAGCATGG - Intronic
1092783780 12:12010045-12010067 CTTTGGCCATAGATGGACCTCGG + Intergenic
1093699567 12:22203665-22203687 ATTCAACCATATCTGGAGCTGGG + Intronic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1097841204 12:64323220-64323242 ATTTAGACACAGCTGGAACTGGG - Intronic
1098401558 12:70081832-70081854 CTTTAGCCATAACTAGATCGGGG + Intergenic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1101517795 12:105452930-105452952 CTTTAGCCAAATCTGGTCCTTGG - Intergenic
1101524001 12:105510974-105510996 CTTTAGTCATGGCTGGATCCAGG + Intergenic
1101526414 12:105535179-105535201 TTTTAGCCATAGCTGGACACAGG + Intergenic
1101763581 12:107678845-107678867 CTTCAGACATAGCTGGATCTAGG - Intergenic
1102175894 12:110874528-110874550 CTTCAGGCATAGCTGGATCCAGG + Intronic
1102542573 12:113633202-113633224 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1103030362 12:117607486-117607508 CATCAGCCAGCGCTGGAGCTGGG + Intronic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1103979266 12:124726021-124726043 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104286036 12:127425875-127425897 CCTTGGGCATAGCTGGATCTAGG - Intergenic
1104434515 12:128745178-128745200 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104743707 12:131196790-131196812 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1107903355 13:45040121-45040143 CTTTAGGCACAACTGGATCTGGG + Intergenic
1108512581 13:51169665-51169687 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1108531381 13:51330364-51330386 CTTTAGTCAAAGCTAGAGCCTGG - Intergenic
1108770950 13:53699947-53699969 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG + Intronic
1110387569 13:74931808-74931830 CTTTACCCTAAGTTGGAGCTAGG - Intergenic
1110603880 13:77408909-77408931 ATTTAGCAAGTGCTGGAGCTGGG + Intergenic
1111051210 13:82884675-82884697 TTTGTGCCACAGCTGGAGCTGGG + Intergenic
1111227134 13:85288751-85288773 TTTTCACCATTGCTGGAGCTGGG + Intergenic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1115289277 14:31751984-31752006 TTTTAGCCATGGCTGGAGCCTGG + Intronic
1115500452 14:34044860-34044882 CTATAACCATATCTGGAGCAAGG + Intronic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117122215 14:52580397-52580419 CTGTAGCCCAAGCTGGAGTTCGG + Intronic
1117768377 14:59107260-59107282 GTTTAACCTTACCTGGAGCTGGG + Intergenic
1118994976 14:70827367-70827389 CTTTAGCAAAAGCTGGCCCTTGG - Intergenic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1120025973 14:79584655-79584677 CTGTACCCATAGCAGTAGCTGGG - Intronic
1120073191 14:80126032-80126054 CTTCAGGCATATCTGGATCTGGG + Intergenic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1123908469 15:24943413-24943435 CATGAGCCATAGGTGCAGCTGGG + Intronic
1124989709 15:34659524-34659546 CGTGAGCCATACCAGGAGCTAGG + Intergenic
1129152089 15:73695750-73695772 CTTCAGGCATAGCTGGATCCAGG + Intronic
1129271191 15:74420097-74420119 TTTTGGTCAGAGCTGGAGCTTGG - Intronic
1132247304 15:100307479-100307501 CTTTAGTCATGGCTGGACCCAGG - Intronic
1132411300 15:101579988-101580010 CTTCAGGCATAGCTGGACCCAGG + Intergenic
1133431461 16:5740610-5740632 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1134562041 16:15219254-15219276 ATCTCCCCATAGCTGGAGCTGGG + Intergenic
1134922579 16:18130883-18130905 ATCTCCCCATAGCTGGAGCTGGG + Intergenic
1135048843 16:19176091-19176113 CTTCAGGCATAGCTGGATCCAGG + Intronic
1135120258 16:19760346-19760368 CTTCAGTCATAGCTGGACCCAGG + Intronic
1135806113 16:25544454-25544476 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1137942175 16:52699067-52699089 GTTTAGGCATGGCTGGAGCAAGG + Intergenic
1138230628 16:55333146-55333168 CTTTAGCCATAGAAGGAGTTTGG - Intergenic
1138519953 16:57565429-57565451 CTTCAGACATAGCTGGATCCAGG + Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140212426 16:72981122-72981144 CTTTAGAGATAGCTGGGGCCCGG - Intronic
1141162670 16:81639641-81639663 CTTTATCCATTGGTGGACCTGGG + Intronic
1141268463 16:82518187-82518209 CTTTAGCCATTTGTGGATCTAGG + Intergenic
1142124806 16:88404968-88404990 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1142240928 16:88944672-88944694 CTTTATCCAAACCTTGAGCTGGG - Intronic
1144717326 17:17443471-17443493 CTTCAGTCATAGCTGGACCCAGG + Intergenic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1147266619 17:39238253-39238275 CTTTGGCCCTGGCTGCAGCTTGG + Intergenic
1147416905 17:40298540-40298562 AATTAGCAGTAGCTGGAGCTGGG - Intronic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1148843843 17:50516994-50517016 CTTTACCCAGAGCTGTACCTTGG - Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1151455321 17:74222344-74222366 CTTGAACCCTAGGTGGAGCTTGG + Intronic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1153307184 18:3642471-3642493 TTTTAGCCCTATCTGGAGATAGG + Intronic
1153814915 18:8783726-8783748 CTTTAGCCGCAGCTTCAGCTCGG - Exonic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1156742374 18:40347569-40347591 ATTCAGAGATAGCTGGAGCTGGG - Intergenic
1157116451 18:44866774-44866796 CTTTACCTCTAGCTTGAGCTGGG - Intronic
1157646511 18:49278797-49278819 CTTCAGTCATAGCTGGTTCTAGG - Intronic
1157905728 18:51568291-51568313 CTTCAGGCATGGCTGGAGCCAGG + Intergenic
1158131517 18:54157783-54157805 CTTGAGCCATCACTTGAGCTGGG - Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160372218 18:78383299-78383321 GTTTAGCCAGACCTAGAGCTGGG - Intergenic
1160678507 19:402964-402986 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1161762755 19:6186625-6186647 CTTCAGGCATGGCTGGATCTGGG + Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163654137 19:18535872-18535894 CTTCAGGCATAGCTGGATCCAGG - Intronic
1165334695 19:35161296-35161318 CTTCAGGCATAGCTGGATCAAGG + Intronic
1165920718 19:39296414-39296436 ATTTAGCCATGGCTGCAGCTTGG + Exonic
1167090737 19:47341866-47341888 CTTCAGGCATAGCTGGATCCAGG + Exonic
1167388420 19:49178415-49178437 CTTGAGCTATAGCTGGGGCCAGG + Intronic
1167925900 19:52820985-52821007 ATTTTCCCAGAGCTGGAGCTGGG + Intronic
1168156173 19:54473955-54473977 TTTTACCCCTAGCTGGGGCTGGG + Intergenic
927044600 2:19264194-19264216 CTTGAGCCAAAACTGGAGTTGGG + Intergenic
929200148 2:39226880-39226902 CCTTAGCCTTTGCTGTAGCTGGG + Intronic
929903170 2:46023589-46023611 CTTGACCCATAGCTTGAACTAGG + Intronic
930016182 2:46972067-46972089 CTTCAGGCAAAGCTGGATCTAGG + Intronic
931710002 2:64980712-64980734 CTACAGCCATAGGTGGACCTAGG - Intergenic
931856501 2:66307456-66307478 CTTTATCCAAAGCTGGAGAAAGG + Intergenic
933663045 2:84943205-84943227 CTTTAGGCATGACTGGATCTAGG - Intergenic
934516030 2:94987404-94987426 CCTAAGCCATAGCTGGAACCCGG + Intergenic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
937124586 2:119465372-119465394 CTGTAGGCATGGCTGGATCTAGG - Intronic
937465323 2:122127326-122127348 TTTTAGCCACAGCTGAAACTGGG - Intergenic
938280125 2:130057874-130057896 ATTCAGCCATGGCTGGAGCTGGG + Intergenic
938331082 2:130448589-130448611 ATTCAGCCATGGCTGGAGCTGGG + Intergenic
938358866 2:130672914-130672936 ATTCAGCCATGGCTGGAGCTGGG - Intergenic
938435259 2:131279567-131279589 ATTCAGCCATGGCTGGAGCTGGG - Intronic
938870930 2:135475561-135475583 CTTTAGCCAAAGCTGGCTTTAGG - Intronic
939833986 2:147105682-147105704 ATTTAGACATAGCTAGATCTAGG - Intergenic
941319680 2:164039435-164039457 TTTTAGCCATGGCTGGATCCAGG - Intergenic
941549894 2:166901956-166901978 TTTTAGCCAGAGATAGAGCTGGG + Intronic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
943278872 2:185904289-185904311 CTTTAGCCATACCAGCTGCTAGG + Intergenic
944110347 2:196125004-196125026 GTTGAGCCACAGCTGGAGATTGG + Intergenic
945158894 2:206868109-206868131 CTTCAGGCATGGCTGGATCTTGG - Intergenic
945948879 2:216020288-216020310 CTTTAGACATAACTGGATCCAGG + Intronic
948466825 2:238156266-238156288 CTTGAGCCATAGCTGCAGCCAGG + Intergenic
949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG + Intergenic
1168845029 20:938630-938652 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172692875 20:36802757-36802779 CTTCAGGTATAGCTGGATCTAGG - Intronic
1173136649 20:40444529-40444551 CTTTAGAGAGAGCTGAAGCTAGG + Intergenic
1173279601 20:41617344-41617366 CATTAGTCATAACTGGAACTAGG + Intronic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1173455634 20:43199154-43199176 CTTCAGGCAAAGCTGGATCTAGG + Intergenic
1174427750 20:50444806-50444828 CTGTAGCCCAGGCTGGAGCTCGG - Intergenic
1174451221 20:50621732-50621754 CTTTAGACATAGCTAGATCCAGG - Intronic
1174582508 20:51582041-51582063 CTTCAGACATGGCTGGATCTAGG - Intergenic
1174734065 20:52947584-52947606 CTTTGGGCATAGCTGGATCCAGG - Intergenic
1175418322 20:58816093-58816115 CTTGAGACATAGCTTGAGGTGGG - Intergenic
1175502345 20:59459601-59459623 CTTGAGGCATGGCTGGATCTAGG - Intergenic
1175820376 20:61905928-61905950 CTTCAGGCATGGCTGGATCTAGG + Intronic
1179434196 21:41349004-41349026 CTTTCCCCATAGCAGGAGCTTGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1182109470 22:27712706-27712728 CTTCAGGCATGGCTGGATCTAGG - Intergenic
1182215651 22:28715349-28715371 CTTCAGGCATGGCTGGATCTAGG - Intronic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1185153010 22:49177167-49177189 CCTCAGCCATGGCTGCAGCTGGG - Intergenic
1185285504 22:49998025-49998047 CTTCAGGCAGAGCTGGGGCTGGG + Exonic
950811062 3:15650492-15650514 CTTCAGCCATTGCTGAATCTAGG + Intergenic
951437274 3:22679395-22679417 CCTTAGCCATAGCCAGAACTAGG + Intergenic
951576298 3:24117702-24117724 CTTCAGGCATGGCTGGATCTGGG - Exonic
953369291 3:42373520-42373542 CTTTAGCCATAGCATGGGCGTGG + Intergenic
955352003 3:58200494-58200516 CTTCAGGCATAGCTGGATCCAGG - Intronic
956900862 3:73714610-73714632 CTTTAGGCATAACTGGATCTAGG - Intergenic
957028560 3:75213988-75214010 CTTCAGGGATAGCTGGATCTAGG - Intergenic
957603348 3:82367325-82367347 CTGTAGCAATAGCTGAATCTTGG - Intergenic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
959365616 3:105454387-105454409 CCTTAGACATGGCTGGATCTGGG + Intronic
960323344 3:116264715-116264737 CCTTAGCCATACCAGTAGCTGGG + Intronic
960571948 3:119193153-119193175 CTTTACCCAAATCTGAAGCTTGG + Intronic
961185679 3:124913065-124913087 GTCTTGCCACAGCTGGAGCTAGG - Intronic
961311850 3:126007383-126007405 CTCTAGCCACTGCTTGAGCTCGG - Intronic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
963640731 3:147858494-147858516 TTTGAGCCGCAGCTGGAGCTGGG + Intergenic
965517694 3:169639219-169639241 CTGAATCCATCGCTGGAGCTTGG - Intronic
966176891 3:177148378-177148400 CTTTAGCCATAAGAGAAGCTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970886368 4:20991788-20991810 TTGTAGCCATGGCTGGGGCTTGG + Intronic
972205574 4:36768269-36768291 GATTAGCAAGAGCTGGAGCTAGG - Intergenic
972721379 4:41702589-41702611 CTTTGACCATAGCTAGACCTTGG + Intergenic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973947541 4:55974093-55974115 CTGTATCCTTAGCTGGTGCTGGG + Intronic
975268125 4:72395210-72395232 CTTTTGCCATATGTGCAGCTGGG - Intronic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
977645928 4:99411636-99411658 CATTAGCAATATCTGTAGCTAGG - Intergenic
977890667 4:102307931-102307953 CTTGAGCCATAGATGAAACTAGG - Intronic
980911118 4:138995416-138995438 CTTTAGGAAGAGCTGGAGCTGGG - Intergenic
981069907 4:140524073-140524095 CGTTAGCAATAGGTGGAGCGCGG + Intergenic
981115628 4:140987523-140987545 CTTTATCAATAACTGGTGCTGGG + Intronic
982116465 4:152102596-152102618 CTTCAGCTACAGCTGGAGCAGGG - Intergenic
982135190 4:152268534-152268556 CTTTATCCACAGCCTGAGCTCGG + Intergenic
982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG + Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983736671 4:171070471-171070493 TTTTAGCTACAGCTGGGGCTGGG + Intergenic
984807295 4:183763448-183763470 CTTTAGCCAGACCTTGAGTTGGG + Intergenic
985964133 5:3326697-3326719 ATTAAGCCATATCTGGAGCCTGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987675025 5:21063399-21063421 TTTTAGCCATAGCCGGAGCTGGG - Intergenic
991985608 5:72283454-72283476 CCTCATCCACAGCTGGAGCTTGG + Intronic
992502632 5:77357350-77357372 CTTTAGCCATGGGTTGAGATGGG + Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
992942872 5:81780087-81780109 CTTGAGCAACAGCAGGAGCTGGG - Intergenic
993599441 5:89902612-89902634 CTGTAGCCCAGGCTGGAGCTAGG + Intergenic
994073761 5:95629007-95629029 TTTTAGCCATGACTAGAGCTGGG + Intergenic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
997868998 5:137490323-137490345 CTAAAGCCAAATCTGGAGCTTGG + Intronic
998261098 5:140632477-140632499 CTTGAGCCACTGCTGCAGCTCGG + Exonic
998310607 5:141126186-141126208 CTTTAGCCACTCCTGTAGCTGGG - Intronic
999667203 5:153925316-153925338 CTTTAGGCATAGCTGGATCCAGG - Intergenic
1001198762 5:169697186-169697208 CTTCAGGCATAGCTGGATCCAGG + Intronic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1002129688 5:177072849-177072871 CTTCAGGCATAGCTGGATCCAGG - Intronic
1002433767 5:179219274-179219296 CTTCAGCCATAGCTGGATTTGGG - Intronic
1005592718 6:27345449-27345471 CAGTATCCATAGCTGGAGTTTGG + Intergenic
1007596788 6:43055885-43055907 CTTTCCCCATACCTGCAGCTCGG + Exonic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1010678069 6:78767717-78767739 CTTTAGCCATGGCGGGAGCTGGG - Intergenic
1014944100 6:127476250-127476272 CCTTAGCCGTAGCTTGAGCTCGG + Exonic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016203697 6:141446222-141446244 CATGAGCCTTATCTGGAGCTAGG - Intergenic
1016285727 6:142470541-142470563 CTTTAGGAATAGCTGCTGCTTGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1019176404 6:170161415-170161437 CTTTAGGCATAGCTGCAGCGCGG - Intergenic
1019496339 7:1342200-1342222 CCTTGGCCATAGCTGGGGATGGG - Intergenic
1020089711 7:5332453-5332475 ACTTAGCCACAGCAGGAGCTGGG - Intronic
1021749953 7:23787134-23787156 CGTTAGCCAGAGGTAGAGCTGGG + Intronic
1022671174 7:32457749-32457771 TATTGGACATAGCTGGAGCTTGG + Intergenic
1026863678 7:73809966-73809988 TTCTGGCCTTAGCTGGAGCTGGG - Intronic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1028556062 7:92126241-92126263 CTTTATCCATACCTGAAACTAGG + Exonic
1029148223 7:98461958-98461980 CTTTAGGCATAGCTGTATCCAGG - Intergenic
1031163741 7:118201406-118201428 CTTTAGGCATCGCTGGATCCAGG - Intergenic
1031315864 7:120257013-120257035 TTTTAGCTATGGCTGGAGCTGGG - Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1034502027 7:151456837-151456859 TTTGAGCCAAAGCTGGAGCTGGG + Intergenic
1035385515 7:158469840-158469862 CTGTCGCCATAACAGGAGCTGGG + Intronic
1035385527 7:158469926-158469948 CTGTTGCCATAACAGGAGCTGGG + Intronic
1035723734 8:1812344-1812366 CTTTGCCCATTGCTAGAGCTGGG - Intergenic
1041567712 8:59299109-59299131 CTTTTGGCTTAGCTGTAGCTGGG + Intergenic
1042699882 8:71600716-71600738 CTTTAGCTGGATCTGGAGCTGGG - Intergenic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1045589282 8:103575844-103575866 CTTTAGGCATATCTGGTGCCAGG - Intronic
1046073822 8:109291995-109292017 CTTGAGCCAAAGCTGAATCTAGG + Intronic
1046643997 8:116765430-116765452 CTTTAGCCAAAACTAGATCTGGG + Intronic
1049572273 8:143374872-143374894 CTTTCGCCATGGCTGGTGCTGGG + Intronic
1050935170 9:11386959-11386981 TTTGAGCCACAGCTGGAACTGGG - Intergenic
1050987547 9:12102232-12102254 TTTTAGACAGGGCTGGAGCTGGG + Intergenic
1051606320 9:18920783-18920805 CTTTAGGCATAGCTGGAACCAGG - Intergenic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1059786415 9:117591151-117591173 CTCTAATTATAGCTGGAGCTAGG - Intergenic
1060814523 9:126627582-126627604 CTTTCCCCAGAGCTGGAGCAGGG + Intronic
1061713113 9:132501164-132501186 CTTCAGGCATAGCAGGATCTAGG + Intronic
1062555850 9:137113146-137113168 GTTTGGGCATAGCTGGCGCTGGG + Intronic
1185666809 X:1772093-1772115 CTTTGGCCATGACTGGAGGTGGG + Intergenic
1187075565 X:15930984-15931006 CTTGATCCATAGCTGGAACAAGG - Intergenic
1187249070 X:17580803-17580825 CTTTACTCATAACTAGAGCTTGG + Intronic
1188106823 X:26156442-26156464 TTTTAGCCATGACTGGAGCAGGG + Intergenic
1188259727 X:28008366-28008388 TTTTAGCCAGTGCTGGAGATGGG + Intergenic
1188633089 X:32392709-32392731 CTTTTGCCATAACTGGCACTTGG - Intronic
1189261084 X:39679261-39679283 CTTCAGACATAGCTGGATTTAGG - Intergenic
1191152537 X:57235161-57235183 CTTAAGCCATAGCTACAGCTTGG - Intergenic
1192180149 X:68911170-68911192 CTTTAGCCCTGGCTGGAGAGAGG - Intergenic
1193142506 X:78042701-78042723 CATTAGCCATTGCCAGAGCTGGG - Exonic
1196323133 X:114368199-114368221 CCTCAGCCAGAGCTGGATCTTGG - Intergenic
1196323530 X:114372490-114372512 CCTCAGCCAGAGCTGGATCTTGG + Intergenic
1199243449 X:145575147-145575169 CTTGAGCCATAGCTAGAGCTGGG - Intergenic
1199329570 X:146543088-146543110 TTTGAGCCATGGCTGGAGCTGGG + Intergenic
1199357155 X:146875689-146875711 TTTTAGCCATGGCTTGAGCCTGG - Intergenic