ID: 986585240

View in Genome Browser
Species Human (GRCh38)
Location 5:9309559-9309581
Sequence CTGGAGGCATGGATTGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986585232_986585240 12 Left 986585232 5:9309524-9309546 CCTCCACTCGAATTTGTCTTTCT 0: 1
1: 0
2: 0
3: 26
4: 286
Right 986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG 0: 1
1: 0
2: 2
3: 27
4: 331
986585231_986585240 24 Left 986585231 5:9309512-9309534 CCTTTGCATGATCCTCCACTCGA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG 0: 1
1: 0
2: 2
3: 27
4: 331
986585233_986585240 9 Left 986585233 5:9309527-9309549 CCACTCGAATTTGTCTTTCTTCC 0: 1
1: 0
2: 0
3: 20
4: 250
Right 986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG 0: 1
1: 0
2: 2
3: 27
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986585240 Original CRISPR CTGGAGGCATGGATTGAAGA CGG Intronic
900333404 1:2148501-2148523 ATGGAGGCCTGGATAGAAGACGG - Intronic
900797752 1:4719590-4719612 CTGCAGGCCTGGATTGTGGAGGG + Intronic
900857612 1:5198594-5198616 CTGGTGTCGGGGATTGAAGAGGG - Intergenic
901699871 1:11039580-11039602 CTGGAAGGATGGATGGATGATGG + Intronic
901847449 1:11992532-11992554 CTGGAGGTGGGGATTGAAAATGG - Intronic
902402377 1:16165348-16165370 GTGGAGGCTTGGAAGGAAGAAGG + Intergenic
902923262 1:19679730-19679752 CTGCAGGCATGGATTAATGCTGG + Intergenic
904379135 1:30099698-30099720 CTGGAGGCGTGCATGGAGGATGG - Intergenic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905607736 1:39318362-39318384 CTGGATACATGGGTTAAAGAGGG + Intronic
905732545 1:40306550-40306572 CAGGAGGTATGGAATGGAGATGG + Intronic
907496194 1:54846399-54846421 CTGGTGGCATGGCTTGTAAAAGG - Intergenic
909007692 1:70296760-70296782 CTGAAGGGAGGGATAGAAGAAGG + Intronic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
911630525 1:100178832-100178854 CTGGAGGCAGGGATGGTGGAAGG - Intergenic
912977144 1:114341159-114341181 ATGGAGGAAGGGAGTGAAGATGG - Intergenic
915466800 1:156103058-156103080 CTTGAGGCAAGGATAGATGAGGG - Intronic
915603668 1:156937908-156937930 ATCGTGGCATGGATGGAAGAGGG - Intronic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
917683408 1:177391547-177391569 CTGGAGGCCTGGTTAGGAGAAGG + Intergenic
918095449 1:181330336-181330358 CTGGAGGCAGGCAGAGAAGAAGG - Intergenic
919001470 1:191837240-191837262 CTAGAGATATGGACTGAAGAAGG - Intergenic
919356078 1:196523455-196523477 CTACAGACATGGATTGAAGCAGG + Intronic
920014403 1:202894712-202894734 CTGGAGGCTTTGATGGAAGCAGG - Exonic
921764075 1:218950016-218950038 TGAGAGGCACGGATTGAAGAAGG + Intergenic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
922919475 1:229289892-229289914 CTGGAAGCATTGATTAAACATGG + Intronic
923746372 1:236704490-236704512 CTGGAGGCCTGGACTTGAGATGG - Intronic
924946536 1:248850517-248850539 CTGGAGTCAGGGACAGAAGAGGG + Intronic
1063383276 10:5600120-5600142 CTGGAGGCATGAATGGATGGCGG - Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1063961708 10:11311375-11311397 TTTGAGGCCTGGGTTGAAGATGG - Intronic
1063978873 10:11437908-11437930 CTGGAGGCGAGGCATGAAGAAGG - Intergenic
1065490559 10:26277758-26277780 CTGGAGGCCTGGAAGGAAAATGG + Intronic
1067142019 10:43666286-43666308 CTGGATTAATGGATTGATGAAGG - Intergenic
1067688050 10:48479588-48479610 CTGGAGGCAAGGGTTCTAGAGGG + Exonic
1067842089 10:49688984-49689006 TTGGAGGCATGCTTTGAGGAGGG + Intronic
1069739695 10:70679561-70679583 CTGGTGGCCTGGATTCTAGATGG - Intronic
1069759563 10:70799290-70799312 CTGGTGGCATGGACTCATGAGGG + Intergenic
1072198384 10:93136786-93136808 CTTGAGGCCAGGATTGAAGCAGG - Intergenic
1073025359 10:100483390-100483412 CTAGAGGCAGAGGTTGAAGATGG + Exonic
1073536550 10:104281831-104281853 CTGGAGACATGCATACAAGAAGG + Intronic
1073776999 10:106797729-106797751 CTGGCTGCATGGACTGAAGGTGG - Intronic
1076700058 10:132266892-132266914 CTTGAGGCATGGAGTGACAATGG + Intronic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077375866 11:2204893-2204915 CTGGGGGCAGGAATTGAAGCAGG - Intergenic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079134001 11:17765857-17765879 CTGCAGGCATGGCGTGTAGAAGG + Intronic
1080849365 11:36054928-36054950 ATGGATGGATGGATTGATGATGG + Intronic
1081626451 11:44658856-44658878 ATGGAGACATGGATGGATGAAGG + Intergenic
1081717398 11:45260116-45260138 CTGGATGCAGAGATTCAAGAGGG - Intronic
1081781449 11:45715947-45715969 CAGGAGGCGTGGAAAGAAGATGG + Intergenic
1082154498 11:48789257-48789279 ATGGAGGCATGTAGTGAAAAAGG - Intergenic
1082576733 11:54815379-54815401 CTGGAGGCCTATATTGAAAAAGG - Intergenic
1083790562 11:64982638-64982660 CTGGAGGGAGGGAATGAAGGAGG - Intergenic
1084543890 11:69804161-69804183 ATAGAAGGATGGATTGAAGATGG + Intergenic
1085064724 11:73483691-73483713 CTGTATGCAGGGCTTGAAGAGGG + Intronic
1085491433 11:76922253-76922275 CTGGAGGCAGGGAGTGCAGGAGG - Intronic
1086109806 11:83187589-83187611 GTGGAGAAATGGGTTGAAGATGG + Intergenic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1089131393 11:116215072-116215094 CTGGTGGCATGGAATGAGCAAGG - Intergenic
1089616109 11:119695756-119695778 CTGGAGGCATGAATTGAATGCGG - Intronic
1091354318 11:134923936-134923958 CTGGAGGTATTGAATAAAGAGGG + Intergenic
1092232370 12:6783268-6783290 CTGGGGGCAGGGTTTGAGGATGG - Intergenic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1094452459 12:30597081-30597103 CAGCAGGCATTGAGTGAAGAAGG + Intergenic
1095694106 12:45124947-45124969 CTGGAGGCATGGATTCTAGTTGG - Intergenic
1096007776 12:48185992-48186014 CTGGAGGCAAGGAGAGAGGAGGG - Intergenic
1096103047 12:48980806-48980828 CCGGAGGCTTGGAACGAAGACGG + Intronic
1096546808 12:52345698-52345720 GTGGGGGAATGGCTTGAAGAAGG + Intergenic
1097973456 12:65659851-65659873 ATGGATGCATGGATTGATAAGGG + Intergenic
1097996433 12:65892740-65892762 CAGGATGAATGGATTGAGGACGG - Intronic
1098039028 12:66335489-66335511 GTGGAGGCAGGTTTTGAAGAGGG + Intronic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1099063154 12:77938091-77938113 CTGGGGCCATGGGTTGAAAAAGG - Intronic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102996361 12:117354145-117354167 CTGAAGGCAAGTCTTGAAGAAGG + Intronic
1104765903 12:131330091-131330113 ATGGATGGATGGATTAAAGAAGG - Intergenic
1104772559 12:131372742-131372764 ATGGAGGGATGGATTGATGGAGG - Intergenic
1104772563 12:131372758-131372780 ATGGAGGGATGGATTGATGGAGG - Intergenic
1104772573 12:131372802-131372824 ATGGAGGGATGGATTGATGGAGG - Intergenic
1104772577 12:131372818-131372840 ATGGAGGGATGGATTGATGGAGG - Intergenic
1104813366 12:131631779-131631801 ATGGATGGATGGATTAAAGAAGG + Intergenic
1105058939 12:133130227-133130249 CTGGAGGCAGGCACTGAGGACGG - Exonic
1106872492 13:34036919-34036941 CTGGGGGCATGTATTTAAAAGGG + Intergenic
1108002046 13:45912664-45912686 CTGGAAGCACAGCTTGAAGATGG - Intergenic
1108840829 13:54612634-54612656 CTATTGGCATGGATTTAAGAGGG + Intergenic
1109254871 13:60067575-60067597 CTCCAGGCATAGTTTGAAGATGG - Intronic
1109895300 13:68679177-68679199 CAGGAGGCATGGAGTGAACCTGG + Intergenic
1111128871 13:83948572-83948594 CTGGAGGCAATGATTGGATAAGG + Intergenic
1111558429 13:89911148-89911170 TTTCAGGCATGGATTGAAGGTGG + Intergenic
1111797776 13:92945322-92945344 CTGGGAGCATGGATTGTGGATGG + Intergenic
1112146600 13:96707069-96707091 CTGGAGGCTTGGATTGGCTATGG + Intronic
1114770888 14:25428208-25428230 GTGGAGGGAAGTATTGAAGATGG + Intergenic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1116493909 14:45537335-45537357 CTGGTGGCATGGACTCATGAGGG + Intergenic
1116890506 14:50263594-50263616 ATGGAGGGATGGATTGTAAATGG + Intronic
1117845448 14:59906755-59906777 CTTGAGGAATTGATAGAAGATGG - Intergenic
1118065415 14:62185341-62185363 CTGGAGGGATGGCATGAGGAGGG + Intergenic
1118251988 14:64170696-64170718 GAGGAGGCATGGAGTGGAGATGG + Intronic
1118862459 14:69675100-69675122 CTGGAAGAATGGTTTGAAGATGG + Intronic
1119531743 14:75366408-75366430 ATGGAAGCCTGCATTGAAGATGG + Intergenic
1120666379 14:87311266-87311288 CGGGAGGCATGGAGGGAGGAAGG - Intergenic
1121277444 14:92677912-92677934 ATGGATGCATGGATGGATGACGG - Intronic
1121739969 14:96244806-96244828 ATGGATGCATGGATGGAGGAGGG - Intronic
1122115558 14:99525682-99525704 GTGGAGGCAGGCACTGAAGAGGG + Intronic
1122600441 14:102918799-102918821 GTGGAGGGATGGATTGATGGTGG - Intergenic
1122639028 14:103146437-103146459 CTGGAGGCATGGATGGGGAAGGG + Intergenic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1124479437 15:30065003-30065025 CTGGAGGCATGAATGGAGGCTGG - Intergenic
1124858030 15:33409885-33409907 CTTTAGGCCTGGATTAAAGAAGG + Intronic
1124864341 15:33474226-33474248 CTGGATGCATGGATGGATGGTGG + Intronic
1125767468 15:42145161-42145183 CTGGAGGGATGGAGTGGAAAAGG + Intronic
1126713075 15:51483345-51483367 ATGTAGGCTTGGAATGAAGACGG - Intronic
1127904531 15:63366409-63366431 TTGGAGGAAAGGATTAAAGAAGG - Intronic
1128958652 15:71976059-71976081 CTGGAGGCATGGATTACAGGCGG + Intronic
1129272736 15:74427998-74428020 CTGGAAGCATGGGGTGCAGAAGG + Intronic
1129701214 15:77769589-77769611 CTGGAGGCAAGGATGGAGGCAGG + Intronic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1130783181 15:87066669-87066691 TTGGAGGCAGGAATTGATGAGGG + Intergenic
1131472390 15:92708504-92708526 CTGGAGGGAGGGTTTGAAGCAGG - Intronic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1134895184 16:17879853-17879875 CTGCAGGCATGGCTTGATCAGGG + Intergenic
1137832798 16:51560109-51560131 TGTGAGGAATGGATTGAAGAAGG + Intergenic
1137977087 16:53041138-53041160 AAGGAGGCATGGATGGATGATGG + Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1138647658 16:58436880-58436902 AAGGAGGGATGGATGGAAGAGGG - Intergenic
1139352801 16:66347850-66347872 GTGGAGGCAGTGAATGAAGAGGG + Intergenic
1140250279 16:73289093-73289115 CTGAAGGCCAGGACTGAAGAGGG + Intergenic
1140623942 16:76769783-76769805 ATGGAGGCATGGCTTGAAAAGGG + Intergenic
1140650614 16:77084061-77084083 CTGAGGGCAAGGCTTGAAGAGGG + Intergenic
1141369206 16:83471671-83471693 CTGAAGGCAGGGTTTGAAGTAGG + Intronic
1142868314 17:2804649-2804671 CTGGAGGCCTGGATTGAATGGGG + Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143362717 17:6384669-6384691 CTGGAGCCATGGAGTGGGGAGGG - Intergenic
1144186816 17:12804299-12804321 CTGGAGGGAGGGGTTGCAGAGGG + Intronic
1144305965 17:13969830-13969852 CTGGAGGCAAGGAGTGGAGTTGG - Intergenic
1144371304 17:14594294-14594316 CAGGAGATATGGATAGAAGAGGG + Intergenic
1144650515 17:17004246-17004268 GTGGAGGAATGGGTTGAAGAGGG - Intergenic
1146239342 17:31202436-31202458 CTGCAGGAATGGATAGAATATGG - Intronic
1146837678 17:36125472-36125494 CTGGAGCCATGGATTGGAGTGGG - Intergenic
1146927090 17:36752710-36752732 CTGGAAGGAGGGATAGAAGACGG + Intergenic
1147241407 17:39093177-39093199 CTGGGGGCAGGGACTGAAGTGGG - Intronic
1147620421 17:41863086-41863108 GTGGAGGCTTCGATTGAGGAGGG - Intronic
1149334589 17:55622482-55622504 CCTAAGGGATGGATTGAAGAAGG - Intergenic
1149527482 17:57367871-57367893 CTGGAGGCCTGGGTAGGAGACGG + Intronic
1150836151 17:68565803-68565825 ATGGAGGCCTGGAGTGGAGAAGG - Intronic
1150842374 17:68620749-68620771 CTGGAGGGAAGGATGGAAAAAGG + Intergenic
1150977556 17:70105777-70105799 CTGAAGGCATGGAATGTAGTAGG - Intronic
1152168239 17:78724757-78724779 GTGGAGGCAGGGCTTGCAGAGGG - Intronic
1158439981 18:57467030-57467052 ATGGAGGCATGGCCTGAAAAAGG - Intronic
1160408159 18:78656855-78656877 CCGGATGCCTGGATTGAAGGGGG - Intergenic
1160435963 18:78853095-78853117 GAGGAGGCGTGGCTTGAAGAGGG + Intergenic
1160502519 18:79409294-79409316 ATGGAGGAATGGATGGATGATGG - Intronic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1161988383 19:7670054-7670076 CTGGAGGCAGGGAGTGAGGGTGG - Intronic
1162203318 19:9037031-9037053 ATGGCTGCATGGATGGAAGAAGG + Intergenic
1162790888 19:13062383-13062405 GTGTAGCCATGGTTTGAAGAAGG + Intronic
1162902866 19:13805629-13805651 GTGGAGGCATGGATGGATGATGG + Intronic
1163050793 19:14682252-14682274 ATGGATGGATGGATTGATGATGG - Intronic
1163548475 19:17952472-17952494 TTGGAGGCGGGGGTTGAAGAAGG - Intronic
1164353602 19:27387544-27387566 TTGGAGGCCTGCATTGAAAAAGG + Intergenic
1165716543 19:38049532-38049554 CTTGAAGCATGGTTTGAAGTGGG - Intronic
1166105210 19:40594790-40594812 ATGGAGGCATGGATTGCTGTAGG + Intronic
1166206590 19:41273765-41273787 GTGGAGACAGGGATTGAAGAAGG - Intronic
1167525099 19:49978729-49978751 AGGGAGGCATGGATGCAAGAAGG + Intronic
1168655621 19:58125513-58125535 ATGGAGGCACGGAGTGAAGAAGG - Intergenic
925120769 2:1416010-1416032 CTTGGGGCATGGATGGAAGCTGG - Intronic
925254621 2:2472550-2472572 CTTTAGGCATGGGTGGAAGATGG - Intergenic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925916923 2:8613589-8613611 ATGGAAGCATGGATGGAAGTAGG + Intergenic
926207674 2:10845760-10845782 TTGGAGGCATGGCCTGAAGCTGG + Intergenic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
926792000 2:16583378-16583400 CTGGATGCATGAATTAAAGGTGG + Intronic
928890312 2:36196695-36196717 CTGGAGGGAAGGATTGGAGTAGG + Intergenic
932320265 2:70817113-70817135 CTGGAGGGAGGAAGTGAAGAAGG + Intronic
932843391 2:75107496-75107518 ATGGAGGCAAGGATGAAAGAAGG + Intronic
933903205 2:86863934-86863956 CTGGAGCCATGAGTTGAAGATGG - Intergenic
933968216 2:87447991-87448013 CTGGATGGATGGATGGTAGATGG + Intergenic
934886113 2:98026846-98026868 CTAGAGGCTTAGATTGAAGAGGG + Intergenic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
935217760 2:100988293-100988315 CTAGAGGCAAGGAGTGAAGCTGG - Intronic
935777310 2:106485013-106485035 CTGGAGCCATGAGTTGAAGATGG + Intergenic
936325581 2:111502513-111502535 CTGGATGGATGGATGGTAGATGG - Intergenic
936523040 2:113224030-113224052 ATGGAGGAATAGATTGAAAAGGG + Intronic
937394082 2:121519385-121519407 CTGGAGGCAGGGACAGAAGAGGG + Intronic
937600676 2:123727698-123727720 ATGGAATCGTGGATTGAAGAGGG - Intergenic
938262497 2:129905747-129905769 CTGGATGCAGGGATTGAAGCTGG - Intergenic
940861315 2:158773286-158773308 CAGGGGGCATGGCTTGGAGAGGG + Intergenic
942763733 2:179429493-179429515 CTGGAAACATGCATTGCAGACGG - Intergenic
943064322 2:183070859-183070881 CTGGAGGCATGGATGGGCAAGGG + Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944119672 2:196227551-196227573 CTGGGGGCATTGATGGTAGAAGG - Intronic
946659135 2:221980491-221980513 ATGGGGGCAGGGAATGAAGATGG + Intergenic
947209859 2:227698675-227698697 CTGGAGGAATGGACTTAAGCGGG + Intronic
948716314 2:239865654-239865676 AGGGAGGGATGGATTGAGGATGG - Intergenic
948738040 2:240023090-240023112 CTGGAGACAGGCATTGAAGCAGG - Intronic
948869256 2:240790087-240790109 CTGGGGGCAAGGATGGAAGGTGG - Intronic
948892916 2:240915935-240915957 CTGGAGGCTTGTATTCTAGAAGG - Intergenic
1168756639 20:323102-323124 ATGCATGCATGGATGGAAGAAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169041689 20:2500715-2500737 CAGCAGGCAGGGATTGGAGAAGG + Exonic
1169055235 20:2615372-2615394 CAGCATGCATGGATGGAAGAAGG - Intronic
1169237688 20:3944773-3944795 ATGGGGGTAGGGATTGAAGAAGG - Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169623172 20:7531313-7531335 CTGGTGGAATTGATTCAAGATGG - Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1171096010 20:22332805-22332827 CTGGAGGCATGGGATGAGAAGGG - Intergenic
1171373986 20:24679613-24679635 CTGGAGGCAGGGCTAGAAGTAGG - Intergenic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1173517089 20:43672266-43672288 GTGTAGGCAAGGATTGAAAAGGG + Intronic
1174577288 20:51545573-51545595 ATGGATGCATGGATGGAAGATGG + Intronic
1174577307 20:51545662-51545684 ATGGATGCATGGATGGAAGATGG + Intronic
1174746989 20:53073093-53073115 ATGGAGGGATGGATGGAAGGAGG - Intronic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1176515906 21:7783259-7783281 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1177631771 21:23738112-23738134 CTACAGGAATGGATTGAAAATGG + Intergenic
1178280238 21:31276120-31276142 CTGGAGGCTGAGCTTGAAGACGG + Intronic
1178529777 21:33366140-33366162 CTGCAGGCATTGAAGGAAGAGGG - Intergenic
1178649934 21:34413271-34413293 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1178924408 21:36762797-36762819 CTGGAGGCCAGGATGGAAGTGGG - Intronic
1179179868 21:39036061-39036083 CAGGAGGCATGGATGGAAGAGGG - Intergenic
1180006300 21:45022538-45022560 CTGGAGGCCCGGGTGGAAGACGG + Intergenic
1180854697 22:19038554-19038576 TTAGAGGCAGGGAATGAAGAAGG - Exonic
1181087878 22:20451268-20451290 CTGGAGGCTTTGATGGAAGCAGG + Intronic
1181257862 22:21575734-21575756 CAGGAGGAATGGCTTGAACATGG - Intronic
1182052766 22:27325622-27325644 GTGGATGGATGGATGGAAGATGG + Intergenic
1184293411 22:43509734-43509756 ATGGAGGGATGGATGGATGAGGG - Intergenic
949093578 3:59436-59458 CTCAAGGACTGGATTGAAGAGGG - Intergenic
949424753 3:3904903-3904925 CTGGAGGCATGAGGTGAAGATGG + Intronic
954293083 3:49660036-49660058 CAGGAGGCATGGAGTGGAGAGGG - Intronic
954533201 3:51338493-51338515 CTGCAGCCATGTATTGTAGAAGG - Intronic
954659806 3:52221037-52221059 CTGGAGGCATGGACAGGAGGAGG - Intergenic
954691680 3:52399058-52399080 CTGCAGGCCTGGATCCAAGATGG + Exonic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
956386681 3:68726643-68726665 GTGGGGGCATGGGTTGAAGTAGG - Intergenic
957024117 3:75160373-75160395 CTGGAGACAGGGATTGAAGAGGG - Intergenic
957255374 3:77829066-77829088 CTTGAGGGATGTAATGAAGAAGG - Intergenic
958796425 3:98711185-98711207 CTGGAGGCAGGGATTGCAGTGGG - Intergenic
959017103 3:101147332-101147354 GTGAAGGCATGGATTGTAGAAGG - Intergenic
960433870 3:117602066-117602088 CAGGAGTCATGGATTTAAAAAGG - Intergenic
962744910 3:138389931-138389953 CTGGAAGCCTGGGTGGAAGAGGG + Intronic
965862822 3:173167993-173168015 CTGGACCCATGGGTTGACGAGGG - Intergenic
967131894 3:186478224-186478246 CTGGAGGCCTGGATTGGATCAGG - Intergenic
969835439 4:9836437-9836459 GTGGAGATGTGGATTGAAGACGG + Intronic
970879095 4:20906809-20906831 ATGGATGTATGGAATGAAGAAGG + Intronic
971067807 4:23054403-23054425 AGGGTGGCATGAATTGAAGAGGG + Intergenic
973197312 4:47461182-47461204 CTGAAGGCATGAATTGGAGGAGG - Intronic
974056476 4:56988155-56988177 CTGGTGGCAGGGTTTGGAGAAGG + Intronic
974199627 4:58622267-58622289 CTGGAGGAGTGGGTTGATGAGGG - Intergenic
974757387 4:66228104-66228126 CTGGAAGAATGGAGTCAAGAGGG + Intergenic
976371467 4:84293380-84293402 CTGGAGTCAAGAAATGAAGAGGG - Intergenic
977324158 4:95553839-95553861 CTGGAAACTTGGATTGAAAATGG + Intergenic
977520747 4:98080750-98080772 CTGGTTGCATGTTTTGAAGATGG - Intronic
978604098 4:110460380-110460402 CTAGAGGTATGGAATGATGATGG + Intronic
983969935 4:173859098-173859120 CTGGTGGCTTTGATTGAATAAGG - Intergenic
984836339 4:184025507-184025529 CTTGAAGCATAGATAGAAGAAGG - Intergenic
985106649 4:186506244-186506266 ATAGGGGCATGGATTGAGGAAGG - Intronic
985703781 5:1389060-1389082 CTGGATGGATGGACAGAAGAAGG - Intergenic
986002930 5:3644246-3644268 CTGGGGGCATTAATTGAGGATGG + Intergenic
986009058 5:3695474-3695496 CAGGTGGTCTGGATTGAAGATGG - Intergenic
986231294 5:5866902-5866924 CTGGTGCCAAGGATTCAAGATGG + Intergenic
986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG + Intronic
989657493 5:43760297-43760319 CTGGTGGCATGGACTTATGAGGG + Intergenic
990624131 5:57592688-57592710 CTGGAGGCTTGGGTGAAAGAGGG + Intergenic
998747318 5:145275390-145275412 CAGGAGGCATGTCTGGAAGAAGG + Intergenic
998808057 5:145938020-145938042 CTGTAGACATGGTTTGCAGAAGG - Exonic
999061490 5:148640304-148640326 CTGGAGCTAGGGATTGGAGAAGG - Intronic
999692204 5:154157857-154157879 CAGGAGGCTGGGATGGAAGAGGG - Intronic
999865186 5:155693676-155693698 CTGGACCCATGTATTCAAGAAGG + Intergenic
1000100424 5:158011136-158011158 CTGGAAGCCTGGCTTGAATAGGG + Intergenic
1000195033 5:158948847-158948869 CGGGAGGCAGGGAATGAAGTAGG - Intronic
1001773645 5:174313030-174313052 GAGGAGGCATGGAAGGAAGAAGG + Intergenic
1001975216 5:175993294-175993316 CTGGAGAGAAGGATTGAAGGGGG - Intronic
1001998034 5:176177693-176177715 CTGGACGCGTGTGTTGAAGAGGG - Intergenic
1002242215 5:177850476-177850498 CTGGAGAGAAGGATTGAAGGGGG + Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005610218 6:27516702-27516724 GTTTAGGCAGGGATTGAAGATGG - Intergenic
1007016280 6:38470417-38470439 ATGGAAGCATAGGTTGAAGACGG + Intronic
1007701413 6:43768595-43768617 GTGGAGGCATGGACTGAGAATGG - Intergenic
1007935936 6:45731971-45731993 GAAAAGGCATGGATTGAAGATGG + Intergenic
1009743080 6:67773334-67773356 TTGGATGCATGATTTGAAGAGGG + Intergenic
1010021395 6:71163858-71163880 CTGGAGGAATGGAGTGAGTATGG - Intergenic
1010565047 6:77400633-77400655 CTGAAGGCAGGGATTTAAAAAGG - Intergenic
1013286568 6:108687083-108687105 CTGTAGGAATGGATTCTAGAAGG + Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1015342348 6:132115707-132115729 CTGGAAGCCTGGATAGAATATGG + Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1017233664 6:152098178-152098200 TTGGAGACATGGATGGAAGCTGG + Intronic
1018537472 6:164836701-164836723 CTGGAGGCATGGACAGGAGGTGG - Intergenic
1019345600 7:528736-528758 GTGGATGAATGGATAGAAGATGG + Intergenic
1019384011 7:743429-743451 CTGTAGGCGTGGATTTAACAGGG - Intronic
1019931138 7:4224073-4224095 CTGGAGGCATGGATTATGGGTGG - Intronic
1020223537 7:6261100-6261122 CTGGAGGCCAGGATTCCAGAGGG + Intronic
1020952185 7:14694118-14694140 CTGGAGGAATGGATTCAAGGAGG - Exonic
1021420926 7:20443761-20443783 ATGGAGGCATGGATGGGAGGAGG + Intergenic
1022335500 7:29417916-29417938 CTAGGGGCCTGGCTTGAAGATGG + Intronic
1022742255 7:33134122-33134144 CTGGAGGCAGGGGTTGCAGTGGG - Intronic
1022822767 7:33977376-33977398 CTGGAGGCATGGAGTTTAGGAGG + Intronic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1028161741 7:87493592-87493614 ATGGAGACATGGAATAAAGAAGG + Intergenic
1031224755 7:119021650-119021672 CTGGAGGACTGGATTGATGGTGG + Intergenic
1031888486 7:127265849-127265871 ATGGATGCATGGATGGATGATGG + Intergenic
1032261616 7:130342010-130342032 CTTGAGGCCTGGGTTGAAGGTGG - Intergenic
1033463170 7:141565687-141565709 CTGGATGCAGGGAATGAAGGAGG - Intronic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1036614906 8:10380720-10380742 CTGGAGAGATGGATGGAAGGAGG + Intronic
1038440918 8:27570216-27570238 ATGGATGCATGGATGGATGAAGG + Intergenic
1039338666 8:36622894-36622916 CTGGAGGCAGGGTTTGGACATGG + Intergenic
1041731603 8:61068689-61068711 CTGGAGGCCTGGCTTGCAGCAGG - Intronic
1041753561 8:61288261-61288283 CGGGAGGGATGGAGTGCAGAGGG - Intronic
1043496207 8:80803420-80803442 CTTGAGGTATAGTTTGAAGATGG - Intronic
1043604542 8:81984354-81984376 TTGGAGGGATAGATTAAAGATGG - Intergenic
1044117306 8:88350715-88350737 CTGGCGGCATGGGTTCACGAGGG + Intergenic
1044606990 8:94056585-94056607 CAGCAGGCAAGGATTGGAGACGG - Intergenic
1047554986 8:125919626-125919648 CTGGAGGGCTGAATTGAAGAAGG + Intergenic
1047670066 8:127136402-127136424 CTGGAGACACGGTTTGAACATGG - Intergenic
1047776502 8:128075547-128075569 GAGGAGACAAGGATTGAAGATGG - Intergenic
1048317510 8:133373203-133373225 TTTGAGCCATGGTTTGAAGATGG + Intergenic
1048989246 8:139751707-139751729 CTGGATGGATGGATGGTAGATGG - Intronic
1049150956 8:141035200-141035222 CTGGAGGCAGAGATTGGAGTGGG + Intergenic
1050458749 9:5858815-5858837 CTGGAAGGATGGATGGATGATGG + Intergenic
1051724636 9:20076445-20076467 ATGGAGGCAGGGATGGAAGGAGG + Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057396633 9:94686653-94686675 CTGGAAGCCTGGTTTGCAGAAGG - Intergenic
1059385656 9:113962309-113962331 ATGGTGGCAGGGACTGAAGAGGG - Intronic
1059755322 9:117288297-117288319 CAGGAGGCATGGATGGTAGCAGG + Intronic
1059819051 9:117951370-117951392 TAGGAGGGAAGGATTGAAGAAGG + Intergenic
1060589020 9:124804237-124804259 GTGGTGGCAGGGATTGAAGTGGG - Exonic
1061370320 9:130194079-130194101 CTAGAGGCATGGACGGCAGACGG - Intronic
1061963040 9:133998057-133998079 ATGGAGGGATGGATGGAAGGAGG - Intergenic
1185497484 X:566325-566347 GTAGAGGAATGGATTGATGATGG + Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185644919 X:1609632-1609654 CTGGAGGCTTGGTTTGAGTAGGG - Intergenic
1185645007 X:1609943-1609965 CTGGAGGCTTGGTTTGAGTAGGG - Intergenic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG + Intronic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1189010912 X:37044926-37044948 CTTGAGACATGGATTGCACAGGG - Intergenic
1189035492 X:37490630-37490652 CTTGAGACATGGATTGCACAGGG + Intronic
1189036985 X:37503967-37503989 CTTGAGACATGGATTGCACACGG + Intronic
1189570515 X:42291010-42291032 GTGGCTGCATGGATGGAAGAGGG + Intergenic
1190809925 X:53873252-53873274 CTGGTGACTTGGATTGGAGAAGG - Intergenic
1190813016 X:53902962-53902984 CTGGTGACTTGGATTGGAGAAGG + Intergenic
1192065318 X:67879224-67879246 ATGGAGACATGGCATGAAGACGG + Intergenic
1192292696 X:69814855-69814877 CTGGTGGCATGGGTTCACGAGGG - Intronic
1197028984 X:121790619-121790641 ATGGAAGCAAGGATAGAAGAAGG - Intergenic
1198409441 X:136350888-136350910 CTGCAGGTAGGGATTGGAGAAGG - Intronic
1199534868 X:148891120-148891142 CTGGAGGACTGGCTTGAAAATGG - Intronic
1200833701 Y:7712296-7712318 ATGGAAGCATGGACTGAAGGGGG - Intergenic