ID: 986589002

View in Genome Browser
Species Human (GRCh38)
Location 5:9349362-9349384
Sequence AACCAACTGTAGGTACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986589000_986589002 -8 Left 986589000 5:9349347-9349369 CCTGCTACATAGAAGAACCAACT 0: 1
1: 0
2: 1
3: 9
4: 143
Right 986589002 5:9349362-9349384 AACCAACTGTAGGTACTGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986589002 Original CRISPR AACCAACTGTAGGTACTGCC TGG Intronic
900169385 1:1258880-1258902 AACCAACTCCAGGTGCAGCCTGG - Intronic
904837407 1:33348373-33348395 ACCCAAATGTTGGAACTGCCAGG - Intronic
912869703 1:113292835-113292857 AACCTATTGTAGGCACTGCTTGG - Intergenic
916321804 1:163512853-163512875 AACCCACAGCAAGTACTGCCTGG - Intergenic
920785060 1:209033355-209033377 AAGCCACTGTAGGCACTGACGGG + Intergenic
1068746092 10:60532358-60532380 AACCAAATGTAGCTGCTACCAGG - Intronic
1072830260 10:98650026-98650048 AAAGAAATGTAGGTTCTGCCTGG - Intronic
1073957215 10:108886895-108886917 TTCCAATTGTAGTTACTGCCGGG - Intergenic
1076604262 10:131678880-131678902 ACCCAACTGTGGTGACTGCCTGG - Intergenic
1078372628 11:10762198-10762220 AAACAAATGTAGGTACCCCCAGG - Intronic
1088357450 11:108958867-108958889 AACCATCTGTAGGAAATGCAAGG - Intergenic
1095214647 12:39533797-39533819 CAGCATCTTTAGGTACTGCCTGG + Intergenic
1096392228 12:51238617-51238639 AACCAAATGCAGGTATTGTCTGG - Intronic
1103532371 12:121611459-121611481 GACCAACTGGAGGCAGTGCCAGG + Intergenic
1107248714 13:38330562-38330584 GACCAACTGTAGGTTTTCCCAGG + Intergenic
1108614084 13:52114416-52114438 AACCAAGGGTAGACACTGCCAGG - Intronic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1113119345 13:106909594-106909616 AACAAACTGTAGCAACTGTCAGG - Intergenic
1116403950 14:44545154-44545176 AACAATCTGAAGGTACTGCTGGG + Intergenic
1117662833 14:58026066-58026088 AATCAACTGTACATCCTGCCAGG + Intronic
1119186878 14:72649369-72649391 CACCAGCTTTAGGAACTGCCAGG + Intronic
1122267872 14:100555084-100555106 GGCCAACTGTAGGTTCTGCTGGG - Intronic
1124707165 15:31975636-31975658 AGCCAACTGTATGTGCTGACTGG + Intergenic
1127244885 15:57161747-57161769 CAAAAACTGTAGGTACTGTCTGG - Intronic
1130406353 15:83605722-83605744 ATCCAACTCTAGGTCCTGGCTGG + Intronic
1141435624 16:83998197-83998219 GACCAGCTGCAGGTGCTGCCGGG - Exonic
1144967145 17:19084420-19084442 AACCAACTGCAGTTAATCCCTGG + Intergenic
1144980775 17:19167647-19167669 AACCAACTGCAGTTAATCCCTGG - Intergenic
1144987447 17:19210586-19210608 AACCAACTGCAGTTAATCCCTGG + Intergenic
1146052751 17:29566577-29566599 CGCCAACTGCAGGTACTCCCGGG + Exonic
1152463669 17:80454321-80454343 AGCCAACAGGATGTACTGCCGGG + Intergenic
1161265910 19:3364456-3364478 AACCAACTGTGTGTGCTGCGGGG + Intronic
1166382746 19:42363181-42363203 ACCCAACTGTACCTCCTGCCTGG + Exonic
1166621825 19:44308214-44308236 AGCCAGCTGTAGGACCTGCCGGG + Intergenic
926286480 2:11492831-11492853 CACCCTCTGTGGGTACTGCCTGG - Intergenic
931736584 2:65199753-65199775 AACCCACAGTAAATACTGCCTGG - Intergenic
931832931 2:66071272-66071294 AGCCAACTGTATGTAAAGCCGGG - Intergenic
942775302 2:179574578-179574600 AATCAACTGTAGCTACTTACAGG + Intronic
945425578 2:209696187-209696209 AACCATCTTTGGGTTCTGCCTGG - Exonic
946920744 2:224579720-224579742 AACTAACTGAAGCTACTTCCAGG + Intronic
947848552 2:233265221-233265243 AACCTCCTGTAGTAACTGCCAGG - Intronic
1172122570 20:32607592-32607614 ACCCCACTGTAGCTCCTGCCAGG + Intronic
1172905974 20:38369565-38369587 AACCAATGGGAGGTACTGTCAGG + Intronic
1178797223 21:35756029-35756051 AAGCAAGTGTAGCAACTGCCTGG + Intronic
1181441437 22:22937742-22937764 AACCAACTATAGGTAGTGCAGGG - Intergenic
1182482694 22:30619698-30619720 AACCAACTGTGGGCCCTCCCTGG - Intronic
1183854269 22:40619514-40619536 AACATACTGAAGGTACAGCCTGG + Intronic
1184700906 22:46171911-46171933 AACCACCTATAGCTTCTGCCCGG - Intronic
950968011 3:17159789-17159811 AGTCAAGTGTAGGTACTGCAGGG - Intronic
951574843 3:24102944-24102966 AGCCAACTATAGCCACTGCCAGG + Intergenic
953532051 3:43747840-43747862 GACCAAATGTGGATACTGCCAGG + Intergenic
961569516 3:127787709-127787731 AACCAAGAGCAGGCACTGCCTGG - Intronic
971771403 4:30901668-30901690 AACCAACTGCAGATAATGTCTGG + Intronic
976785951 4:88821222-88821244 AACCAAAGGTAGGTACAGGCTGG + Intronic
978856060 4:113396275-113396297 AACCATCTTTAGGTACAGACAGG + Intergenic
984732227 4:183078725-183078747 ACCCATCTGCAGGTACTGCAGGG - Intergenic
986589002 5:9349362-9349384 AACCAACTGTAGGTACTGCCTGG + Intronic
988677553 5:33448378-33448400 AACCAAATTGAGGTAATGCCGGG + Intronic
991764799 5:69963442-69963464 AACCAACTGCAGGTAATTGCAGG - Intergenic
991782525 5:70154711-70154733 AACCAACTGCAGGTAATTGCAGG + Intergenic
991844031 5:70838513-70838535 AACCAACTGCAGGTAATTGCAGG - Intergenic
991874968 5:71155024-71155046 AACCAACTGCAGGTAATTGCAGG + Intergenic
992169202 5:74085496-74085518 AACCAAATGTAAGTACAGCCAGG - Intergenic
998590692 5:143474792-143474814 TACCAACGGTATGTACTGTCTGG + Intergenic
1001557974 5:172649119-172649141 AACTAACTGTGGGAACTGTCTGG + Intronic
1001844002 5:174904598-174904620 AAGCAGCTGGAGGTCCTGCCCGG - Intergenic
1002463143 5:179386912-179386934 AACCAACTGTAGACACTGTAAGG + Intergenic
1003168902 6:3704874-3704896 AGATAACTGTAGGTACTGCTTGG + Intergenic
1006013199 6:31059496-31059518 AACCAACTGTAGTCACTGCTGGG - Intergenic
1008521447 6:52365166-52365188 CCCCAGCTGTAGGTAATGCCTGG + Intronic
1009537446 6:64907566-64907588 AAAGAACTGTAAGTTCTGCCAGG + Intronic
1017959251 6:159207410-159207432 AAACTACTGTAGGTTCTTCCAGG - Intronic
1019009717 6:168834308-168834330 AACCAGATGTAGGAACTGCATGG + Intergenic
1025099325 7:56122341-56122363 ACCCAAGGGAAGGTACTGCCGGG + Intergenic
1030990323 7:116291511-116291533 AACCCATGGTAAGTACTGCCTGG - Intronic
1033784242 7:144711679-144711701 AAACAACTGTAAGCACTGCATGG + Intronic
1033836010 7:145312990-145313012 AGCCAACTGTATGTAATGCCTGG + Intergenic
1034592442 7:152153240-152153262 GACCACCTGTAGGAACTGACGGG - Intronic
1034982865 7:155489762-155489784 GGGCAACTGTAGGCACTGCCCGG + Intronic
1045994576 8:108347757-108347779 AACCAACTGCAGGTAAGGGCTGG + Intronic
1051920042 9:22253942-22253964 AACCAACTGTATGTCATCCCAGG - Intergenic
1062200220 9:135298930-135298952 AACCCCCTGTGGGAACTGCCCGG - Intergenic
1185948585 X:4404836-4404858 AACCAAGTGTAATTATTGCCAGG - Intergenic
1187715637 X:22099628-22099650 AAACAACTTTAGGAACTGCCAGG + Intronic
1188501709 X:30834048-30834070 AACCATCTGCAGCTGCTGCCTGG + Exonic
1190404066 X:50068594-50068616 AACCAATTGTAAGTACAGCTTGG + Intronic
1191841869 X:65519075-65519097 AACCTACTGCAGGCACTGCGGGG + Intronic
1191859752 X:65656688-65656710 AACCTACTGCAGGCACTGCGGGG + Intronic
1193366262 X:80637555-80637577 AGCCCACAGTAAGTACTGCCTGG + Intergenic
1199982988 X:152931122-152931144 AATCAACAGTAGCTATTGCCAGG + Intronic